ID: 1141010476

View in Genome Browser
Species Human (GRCh38)
Location 16:80392494-80392516
Sequence AAATATATACTATACTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141010474_1141010476 -9 Left 1141010474 16:80392480-80392502 CCATACAAACAAATAAATATATA No data
Right 1141010476 16:80392494-80392516 AAATATATACTATACTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141010476 Original CRISPR AAATATATACTATACTGGTG AGG Intergenic
No off target data available for this crispr