ID: 1141015201

View in Genome Browser
Species Human (GRCh38)
Location 16:80442477-80442499
Sequence TATGAGACACAACCAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141015201_1141015204 8 Left 1141015201 16:80442477-80442499 CCCTGAGCTGGTTGTGTCTCATA No data
Right 1141015204 16:80442508-80442530 GCAATATTGAGCTCCTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141015201 Original CRISPR TATGAGACACAACCAGCTCA GGG (reversed) Intergenic
No off target data available for this crispr