ID: 1141018710

View in Genome Browser
Species Human (GRCh38)
Location 16:80474815-80474837
Sequence CTTTATAAGTGGAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141018710_1141018718 7 Left 1141018710 16:80474815-80474837 CCTTCCTTCTTCCACTTATAAAG No data
Right 1141018718 16:80474845-80474867 TTACACTGGGCCCACCTGGATGG No data
1141018710_1141018713 -7 Left 1141018710 16:80474815-80474837 CCTTCCTTCTTCCACTTATAAAG No data
Right 1141018713 16:80474831-80474853 TATAAAGACCCTTATTACACTGG No data
1141018710_1141018714 -6 Left 1141018710 16:80474815-80474837 CCTTCCTTCTTCCACTTATAAAG No data
Right 1141018714 16:80474832-80474854 ATAAAGACCCTTATTACACTGGG No data
1141018710_1141018719 13 Left 1141018710 16:80474815-80474837 CCTTCCTTCTTCCACTTATAAAG No data
Right 1141018719 16:80474851-80474873 TGGGCCCACCTGGATGGTCCAGG No data
1141018710_1141018717 3 Left 1141018710 16:80474815-80474837 CCTTCCTTCTTCCACTTATAAAG No data
Right 1141018717 16:80474841-80474863 CTTATTACACTGGGCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141018710 Original CRISPR CTTTATAAGTGGAAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr