ID: 1141026241

View in Genome Browser
Species Human (GRCh38)
Location 16:80551520-80551542
Sequence GACAGCTTAGTGGCTGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141026241_1141026247 24 Left 1141026241 16:80551520-80551542 CCCCTGACAGCCACTAAGCTGTC No data
Right 1141026247 16:80551567-80551589 TCAAAAATGTTATGTAGGCCAGG No data
1141026241_1141026246 19 Left 1141026241 16:80551520-80551542 CCCCTGACAGCCACTAAGCTGTC No data
Right 1141026246 16:80551562-80551584 AAATATCAAAAATGTTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141026241 Original CRISPR GACAGCTTAGTGGCTGTCAG GGG (reversed) Intergenic
No off target data available for this crispr