ID: 1141027809

View in Genome Browser
Species Human (GRCh38)
Location 16:80564329-80564351
Sequence GCTCTGTCCTTGGGCAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141027800_1141027809 5 Left 1141027800 16:80564301-80564323 CCCATTCTACCCTAGCTGGCTGG No data
Right 1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG No data
1141027795_1141027809 28 Left 1141027795 16:80564278-80564300 CCTGGGCAGCACCTGCACCCTCT No data
Right 1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG No data
1141027806_1141027809 -5 Left 1141027806 16:80564311-80564333 CCTAGCTGGCTGGAGGAGGCTCT No data
Right 1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG No data
1141027805_1141027809 -4 Left 1141027805 16:80564310-80564332 CCCTAGCTGGCTGGAGGAGGCTC No data
Right 1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG No data
1141027802_1141027809 4 Left 1141027802 16:80564302-80564324 CCATTCTACCCTAGCTGGCTGGA No data
Right 1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG No data
1141027797_1141027809 11 Left 1141027797 16:80564295-80564317 CCCTCTCCCATTCTACCCTAGCT No data
Right 1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG No data
1141027798_1141027809 10 Left 1141027798 16:80564296-80564318 CCTCTCCCATTCTACCCTAGCTG No data
Right 1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG No data
1141027796_1141027809 17 Left 1141027796 16:80564289-80564311 CCTGCACCCTCTCCCATTCTACC No data
Right 1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141027809 Original CRISPR GCTCTGTCCTTGGGCAAAAG TGG Intergenic
No off target data available for this crispr