ID: 1141027848

View in Genome Browser
Species Human (GRCh38)
Location 16:80564739-80564761
Sequence CTCTGTTACCACCTGCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141027848_1141027850 12 Left 1141027848 16:80564739-80564761 CCATGCAGCAGGTGGTAACAGAG No data
Right 1141027850 16:80564774-80564796 CCCCATTCTGTCTGCTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141027848 Original CRISPR CTCTGTTACCACCTGCTGCA TGG (reversed) Intergenic
No off target data available for this crispr