ID: 1141031060

View in Genome Browser
Species Human (GRCh38)
Location 16:80588988-80589010
Sequence CTGTGATAGGGGCAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141031049_1141031060 17 Left 1141031049 16:80588948-80588970 CCATCACATGTACTGTGAGCTCA No data
Right 1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG No data
1141031051_1141031060 -6 Left 1141031051 16:80588971-80588993 CCAGCACCTTCCCCAGGCTGTGA No data
Right 1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141031060 Original CRISPR CTGTGATAGGGGCAAGAGGA AGG Intergenic
No off target data available for this crispr