ID: 1141033117

View in Genome Browser
Species Human (GRCh38)
Location 16:80606736-80606758
Sequence GTGGGAGATAATTCAATGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8526
Summary {0: 1, 1: 1, 2: 175, 3: 1916, 4: 6433}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141033110_1141033117 1 Left 1141033110 16:80606712-80606734 CCCACATGTTGTGGGAGGGACCC 0: 735
1: 2330
2: 4046
3: 5075
4: 5145
Right 1141033117 16:80606736-80606758 GTGGGAGATAATTCAATGACGGG 0: 1
1: 1
2: 175
3: 1916
4: 6433
1141033111_1141033117 0 Left 1141033111 16:80606713-80606735 CCACATGTTGTGGGAGGGACCCT 0: 27
1: 882
2: 2547
3: 4320
4: 5504
Right 1141033117 16:80606736-80606758 GTGGGAGATAATTCAATGACGGG 0: 1
1: 1
2: 175
3: 1916
4: 6433
1141033104_1141033117 10 Left 1141033104 16:80606703-80606725 CCCATAGTTCCCACATGTTGTGG 0: 6
1: 759
2: 2048
3: 3617
4: 4382
Right 1141033117 16:80606736-80606758 GTGGGAGATAATTCAATGACGGG 0: 1
1: 1
2: 175
3: 1916
4: 6433
1141033106_1141033117 9 Left 1141033106 16:80606704-80606726 CCATAGTTCCCACATGTTGTGGG 0: 8
1: 746
2: 2049
3: 3618
4: 4354
Right 1141033117 16:80606736-80606758 GTGGGAGATAATTCAATGACGGG 0: 1
1: 1
2: 175
3: 1916
4: 6433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141033117 Original CRISPR GTGGGAGATAATTCAATGAC GGG Intronic
Too many off-targets to display for this crispr