ID: 1141033384

View in Genome Browser
Species Human (GRCh38)
Location 16:80608559-80608581
Sequence GCCAATGATGTCATCACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141033384_1141033386 9 Left 1141033384 16:80608559-80608581 CCAGCCGTGATGACATCATTGGC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1141033386 16:80608591-80608613 CACACAGCCCACAACAGCCCAGG 0: 1
1: 0
2: 3
3: 44
4: 408
1141033384_1141033387 10 Left 1141033384 16:80608559-80608581 CCAGCCGTGATGACATCATTGGC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1141033387 16:80608592-80608614 ACACAGCCCACAACAGCCCAGGG 0: 1
1: 0
2: 4
3: 28
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141033384 Original CRISPR GCCAATGATGTCATCACGGC TGG (reversed) Intronic
913554425 1:119950755-119950777 GCCACTTATGTCATCAAAGCAGG + Exonic
914754670 1:150556166-150556188 GCCAAGGATCCCATCACAGCCGG - Exonic
917163307 1:172081872-172081894 GCCAATGAAGTCTTCATGGTTGG - Exonic
919193551 1:194254319-194254341 GCCAATGTTTTCCTCAAGGCTGG + Intergenic
922391857 1:225151808-225151830 GCCAAAGTTGTCATCCCTGCTGG - Intronic
1064202237 10:13294613-13294635 GCAAATGATGTCGTTACCGCTGG + Intronic
1065602645 10:27385707-27385729 TCCAATTATCTCATCATGGCTGG - Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1067148543 10:43711075-43711097 ACAAATGATGCCATCAGGGCAGG + Intergenic
1078798466 11:14618017-14618039 GCAAATGATGTCCTCACAGAAGG - Intronic
1084326540 11:68403625-68403647 GTCAATGATGACGTCCCGGCTGG - Exonic
1092014003 12:5141568-5141590 ACAAATGAAGTCATCACTGCAGG + Intergenic
1092995711 12:13948539-13948561 GCCAAAGATTTCAACACGGTTGG + Intronic
1094486403 12:30928808-30928830 AACAATGATGTGATCATGGCTGG - Intronic
1098866449 12:75769055-75769077 GCCAATGAATTCATAACTGCAGG - Intergenic
1103716395 12:122947737-122947759 GCCCATGATGGCATCACAGCGGG + Intronic
1104931270 12:132340669-132340691 GACAAGGCTGTCACCACGGCTGG - Intergenic
1125710586 15:41782421-41782443 GCGAATGTTGTCATCAGGGTGGG + Intronic
1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG + Exonic
1129183730 15:73893054-73893076 GGTAATGATGTCATCACTGGTGG + Intergenic
1133586364 16:7199568-7199590 GCCAATAATCTGATCAGGGCTGG + Intronic
1137747956 16:50837056-50837078 GCCAATGAAGTTATGACAGCAGG - Intergenic
1137777291 16:51066475-51066497 GCCAATGGTGAGATCATGGCGGG + Intergenic
1139602720 16:67996413-67996435 GGCAATGATGTGATCTTGGCGGG + Intronic
1141033384 16:80608559-80608581 GCCAATGATGTCATCACGGCTGG - Intronic
1145100426 17:20072226-20072248 TCCAATGATGTCATCAGGAATGG - Intronic
1145107188 17:20128222-20128244 GTCACTGATGTCAACACGCCTGG - Intronic
1153768349 18:8396000-8396022 GCCACTGATGGCATCACGCCTGG - Intronic
1163855297 19:19697095-19697117 TCCAATGATGTAATCAAGCCGGG - Intergenic
1164640568 19:29822424-29822446 GCCCACGATGTCTTCACTGCAGG + Exonic
1165016950 19:32888292-32888314 TCAAATGATGTCATCTCTGCTGG - Intronic
1165322859 19:35096952-35096974 GCCAAAGATGGCATCACTGAGGG - Intergenic
1166874509 19:45889341-45889363 GCCCATAATGTCATGAAGGCAGG - Intergenic
925012045 2:493490-493512 GGCAATGACATCATCACGTCAGG + Intergenic
930054867 2:47244211-47244233 GCCGAGGAAGCCATCACGGCAGG + Intergenic
938796921 2:134725167-134725189 GCCAACCATGTCATCCAGGCTGG + Intergenic
945923550 2:215780366-215780388 GAGAAAGATGCCATCACGGCAGG + Intergenic
948397011 2:237652310-237652332 GTCAATGATGTGAACACGGCTGG + Intronic
1169155387 20:3325247-3325269 TCCACTGCTGTCATCACAGCTGG - Intronic
1172505458 20:35458487-35458509 GCCAATGTTATCATTACTGCAGG - Intronic
1174124766 20:48296157-48296179 TGCAATGATGTCATCAGGTCCGG + Intergenic
1174834069 20:53839646-53839668 GCCACTGAGGTCATGACTGCAGG + Intergenic
1175507394 20:59495595-59495617 GCCCATGATGTCCTCACAGGTGG + Intergenic
1181504544 22:23343353-23343375 TCCAATGTTGTCATCAGTGCTGG - Intergenic
1181655662 22:24295965-24295987 TCCAATGTTGTCATCAGTGCTGG - Intronic
1181709542 22:24673584-24673606 TCCAATGTTGTCATCAGTGCTGG - Intergenic
953547416 3:43873753-43873775 TCAAATGAGGTCATCAGGGCGGG + Intergenic
966287301 3:178312679-178312701 GCCAGTGTTGCCATCTCGGCTGG - Intergenic
967107444 3:186265505-186265527 GCCCGTGATGTCATCACTGGAGG - Intronic
968912536 4:3483462-3483484 GCCACTGATGTCAGCTCTGCTGG + Intronic
969946746 4:10791048-10791070 GGCAATGAGGTCATTAGGGCGGG - Intergenic
980918627 4:139059560-139059582 CCCAATGATGTCATTACAACAGG + Exonic
990254344 5:53950352-53950374 GACGACGATGTCATGACGGCTGG + Intronic
991697688 5:69288384-69288406 GCCAATGATGTAATCACCAATGG + Intronic
998522513 5:142813724-142813746 GCAAATGAGGTCATTAGGGCAGG - Intronic
1002907657 6:1463932-1463954 TTCAATGATGTCATCAGGGTGGG - Intergenic
1003098690 6:3160722-3160744 GCCAATGATGCCTTCAGGGTAGG - Intergenic
1006887090 6:37390925-37390947 GCCAATGATGGCAGCAGGGCTGG - Exonic
1017122451 6:151037459-151037481 CAAAATGATGTCATCACGGTGGG + Intronic
1020504403 7:8965425-8965447 TACAATGATGGCACCACGGCAGG + Intergenic
1037635523 8:20698440-20698462 GCGAATGATGTCAGCAGAGCAGG + Intergenic
1039742549 8:40395890-40395912 GCCTATGATGTGATCACAGATGG + Intergenic
1042161380 8:65899353-65899375 GGAAATGATGACAGCACGGCAGG - Intergenic
1047469473 8:125155213-125155235 GGCAATAATGTCTTCAGGGCAGG + Intronic
1052051959 9:23859183-23859205 ACCAATGATTTCATCAGGGTAGG + Intergenic
1053056676 9:34997086-34997108 TGCAATGATGTCATCAAGCCAGG + Exonic
1055625569 9:78173903-78173925 ACCAATGATCTCATCATGGCTGG + Intergenic
1055684190 9:78753238-78753260 GCCAATGATCTCATCAAGCCAGG - Intergenic
1056571247 9:87817368-87817390 CCCAATGATGTCATTACAACAGG - Intergenic
1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG + Intronic
1061357841 9:130119775-130119797 GGAAATGATGGCATCACGACTGG + Intronic
1186273388 X:7914389-7914411 GCCAATGATGTCATTGCTACCGG - Intronic
1187696128 X:21922860-21922882 TCCAATGTTTTCATCACAGCTGG - Intergenic
1187789077 X:22928376-22928398 GCCAATGGTGTCAGCAAGGAGGG + Intergenic
1189262792 X:39689762-39689784 GCCAGTGATGGCAGCAGGGCGGG - Intergenic
1190335757 X:49260787-49260809 GCCATTGACGTCATGGCGGCCGG + Intronic
1199965920 X:152820933-152820955 GCCTTTGATGTCATCATAGCCGG - Intergenic