ID: 1141033936

View in Genome Browser
Species Human (GRCh38)
Location 16:80612127-80612149
Sequence GGAGGGGAAGACGCCCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141033933_1141033936 -7 Left 1141033933 16:80612111-80612133 CCAATACCACATGAGTGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 280
1141033926_1141033936 30 Left 1141033926 16:80612074-80612096 CCCTTGCAGGCGCATGTGACCAG 0: 1
1: 1
2: 0
3: 6
4: 80
Right 1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 280
1141033927_1141033936 29 Left 1141033927 16:80612075-80612097 CCTTGCAGGCGCATGTGACCAGA 0: 1
1: 1
2: 1
3: 5
4: 88
Right 1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 280
1141033929_1141033936 11 Left 1141033929 16:80612093-80612115 CCAGAAGCTGAGTCATGGCCAAT 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141033936 Original CRISPR GGAGGGGAAGACGCCCCTGC CGG Intronic
900097052 1:944052-944074 GGAGGGGGCCACGCCCTTGCCGG + Exonic
900120541 1:1046911-1046933 TGATGGGAAGACGCCCTCGCTGG + Exonic
900343062 1:2197691-2197713 GGAGGGGAAGAGCCCCCAGGAGG - Intronic
901143518 1:7050737-7050759 GGAGGGGAAGGAGCCCCAGGGGG + Intronic
901225460 1:7610679-7610701 GGAGGGGCAGAGGCCACTTCTGG - Intronic
902696518 1:18144182-18144204 GGAGGAGCAGAGGCTCCTGCTGG - Intronic
902877586 1:19350067-19350089 GGAGGAGGAGAGGCGCCTGCTGG - Intronic
903269297 1:22177721-22177743 AGAGGGGAAGGCACCCGTGCAGG + Intergenic
903692679 1:25185406-25185428 GGAGGGGAAGGGCCCCCTGAAGG + Intergenic
905473199 1:38208153-38208175 GGAAGAGAAGACTCGCCTGCTGG + Intergenic
905531739 1:38685287-38685309 GGAGGTAAAGACCCCCCTGTGGG + Intergenic
905644562 1:39616324-39616346 GGAGGCAGAGACGCCCTTGCTGG - Intergenic
905784767 1:40745763-40745785 GGAGGGGAGGGATCCCCTGCGGG - Intronic
905968135 1:42116581-42116603 GCTGGGTAAGAGGCCCCTGCAGG + Intergenic
906148008 1:43571283-43571305 GGAAGGGAAGATGCTGCTGCAGG - Intronic
906209428 1:44003897-44003919 GGCTGGGGAGATGCCCCTGCAGG - Intronic
906377046 1:45304125-45304147 GGATGGGATGACGCCACTGGAGG - Intronic
906568019 1:46814222-46814244 GGAGCGGAAGGCAGCCCTGCAGG + Exonic
910938204 1:92504521-92504543 GGAGGGGAAGAGCCCCTTGGTGG + Intergenic
911025073 1:93427301-93427323 GGAGGGGGAGCCTCCTCTGCAGG - Intergenic
911863581 1:102987694-102987716 AGAGGGGAAGATGGCCCTGAAGG - Exonic
913267510 1:117059806-117059828 CCAGGGGAAGCCGCCGCTGCAGG - Intergenic
913287579 1:117240971-117240993 GGAGTGGAAGACTCACCAGCAGG - Intergenic
915217449 1:154349553-154349575 TGAGGGGCCGAGGCCCCTGCAGG - Exonic
918756061 1:188340372-188340394 GGAGGGGATGTTGCCCCTGCTGG + Intergenic
919766271 1:201129241-201129263 GGAGGAGAAGTCGCCCCACCTGG + Intergenic
920079404 1:203361412-203361434 GGATGGGAAGGAGCACCTGCTGG + Intergenic
920535324 1:206733378-206733400 GCAGAGGGAGACGGCCCTGCTGG + Exonic
921176556 1:212600178-212600200 GGAGAGGAAGATGCCCATGGAGG - Intronic
922161387 1:223081262-223081284 TGAGGGAAAGAGGCCCCTCCGGG + Intergenic
922218470 1:223539768-223539790 GGAGGAGATGTGGCCCCTGCAGG - Intronic
924708762 1:246518124-246518146 GGAGGGGCAGCTGTCCCTGCTGG - Intergenic
1062921650 10:1284900-1284922 GGAGGGGAAGTCACCCCTCAAGG - Intronic
1064003634 10:11683414-11683436 GGAAAGGAAGAAGCCCCTGAAGG - Intergenic
1066059044 10:31706277-31706299 GAAGGGGAGGAGGCCCCCGCTGG - Intergenic
1067110541 10:43396910-43396932 GGAGGGGAGGGGGCCCCTGGCGG + Intronic
1067139877 10:43648381-43648403 GGAGGAGAGGCAGCCCCTGCGGG - Intronic
1067766285 10:49090014-49090036 GGAGTGGAAGAGGCCCCAGCAGG + Intronic
1069163493 10:65119292-65119314 GGAGAGGAAGACCCACCTTCAGG + Intergenic
1070626726 10:78056089-78056111 GGAGGGGGAGATGCCTCTGGTGG + Exonic
1072669962 10:97422102-97422124 GTAGGGGAAGACTTGCCTGCCGG - Intronic
1073095036 10:100974125-100974147 GGAGATGAAGATGCCACTGCGGG - Intronic
1075112355 10:119597339-119597361 GGAGGGCCGGACGGCCCTGCTGG - Intergenic
1076606957 10:131695390-131695412 GGAGGGGGAGAGGCCCCAGGAGG + Intergenic
1076676319 10:132149462-132149484 GGACGGGAAGAGCCCCCTCCAGG + Exonic
1076765347 10:132630230-132630252 TGAGGGGAAGACGTCCATGAGGG + Intronic
1076765428 10:132630586-132630608 TGAGGGGAAGACGTCCATGAGGG + Intronic
1076804227 10:132847171-132847193 GGAGGGGCAGCCGCACCTTCAGG + Exonic
1077077305 11:707458-707480 GGAGGGGAGGAGGTCCCAGCAGG - Intronic
1077142836 11:1031926-1031948 GGTGGGGAAGGCGTCCTTGCAGG + Exonic
1077226649 11:1441614-1441636 GGAGGGGATGATGCACCTGAGGG - Intronic
1077226731 11:1441906-1441928 GGAGGGGATGATGCACCTGAGGG - Intronic
1077240692 11:1508899-1508921 AGAGGGGAATGTGCCCCTGCAGG - Intergenic
1077292401 11:1803997-1804019 GGAGGGGAAGACGGCCCAGGGGG + Intergenic
1077476329 11:2792132-2792154 GGAGGGGACGCCGGGCCTGCAGG - Intronic
1077504475 11:2923734-2923756 GGCTGGGAAGAGGCCCCTGGAGG + Intronic
1078182108 11:9020555-9020577 GGAGGGAAGGAGACCCCTGCAGG - Intronic
1078182843 11:9027135-9027157 AGAGGGGAAGACTGACCTGCAGG + Intronic
1079367568 11:19822688-19822710 GGAGGGGAAGAGCCATCTGCTGG - Intronic
1084045503 11:66565699-66565721 GGAGGGCAAGCCGCCCATGCAGG + Exonic
1084641921 11:70431345-70431367 GGAGTGGAGGAAGCCCTTGCAGG + Intronic
1084679915 11:70660954-70660976 GGAGGGGAAGCTGCGCGTGCAGG + Intronic
1085774321 11:79351895-79351917 GGAGGTGAAGAGCCCCGTGCTGG + Intronic
1088264795 11:107978959-107978981 GGAGGGGATGTTGCCACTGCTGG - Intergenic
1088487605 11:110355858-110355880 GGAGGGGGAGACGCTCAGGCAGG - Intergenic
1089459384 11:118643849-118643871 GGAGGGGAGGGGGCCGCTGCGGG - Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1091923518 12:4324566-4324588 AGTGGTGAAGACGCACCTGCGGG - Intronic
1092130936 12:6112752-6112774 GGAGAGGAAGAGTCCCCAGCAGG + Intronic
1093414701 12:18906955-18906977 GGAGGGTCAGAGGCTCCTGCTGG - Intergenic
1093964207 12:25308373-25308395 GGAGGGGATGTTGCCACTGCTGG - Intergenic
1096538438 12:52289798-52289820 GGTGGGGAGGAAGCCTCTGCAGG - Intronic
1096540341 12:52303566-52303588 GGTGGGGAGGAAGCCTCTGCAGG + Intronic
1097142883 12:56917644-56917666 GGAAAGGAAGAAGCCCCTGGAGG + Intergenic
1100140315 12:91610683-91610705 GGAGAGACAGACTCCCCTGCTGG + Intergenic
1101172090 12:102108160-102108182 GGAGGGGAAGACCCACCCTCAGG + Intronic
1101692274 12:107093412-107093434 GGAGGGGAATGAGCCCCTGTCGG + Exonic
1101916326 12:108898864-108898886 GGACGGGAAGATGCCACCGCTGG + Intronic
1101955598 12:109209347-109209369 GCAGGGGAGCACGCACCTGCTGG - Exonic
1102462676 12:113109750-113109772 GGAGGGGAAGATGCTCCCTCTGG - Intronic
1103228631 12:119309199-119309221 GGAGGGGAAGGTGCACCTGGTGG + Intergenic
1104927659 12:132321980-132322002 GGAGGGGAGGACGCCCCTTGGGG - Intronic
1107978715 13:45714156-45714178 GGAGGAGAACAGGACCCTGCAGG + Exonic
1108633345 13:52308675-52308697 GCTGGGGGAGACGCCCATGCTGG - Intergenic
1108653347 13:52503883-52503905 GGCTGGGGAGACGCCCATGCTGG + Intergenic
1110219758 13:73059803-73059825 GGAGGGGAATCTGCCCCGGCGGG + Intronic
1112142483 13:96660842-96660864 GGAGAGGAAGACCCACCTTCAGG + Intronic
1112504839 13:99969566-99969588 GGAGGGGAAGGGACCCCTCCGGG - Intronic
1116158732 14:41239260-41239282 GGAGGGGATGTCGCCACTACTGG + Intergenic
1116937816 14:50760107-50760129 GGAGGAAAAGACTCACCTGCAGG - Exonic
1119433581 14:74583921-74583943 GGAGGAGGTGAGGCCCCTGCCGG - Intronic
1121731132 14:96187930-96187952 GCAGGGCAACAAGCCCCTGCAGG + Intergenic
1122968686 14:105143764-105143786 GGTGGTGAAGTCGCCACTGCAGG - Intronic
1122979606 14:105185636-105185658 GGAGGCGAAGTGGCCCCTGTTGG + Intergenic
1124071414 15:26396475-26396497 AGAGGGGAAGGCACCCCTCCAGG - Intergenic
1125541134 15:40470899-40470921 AGAGGGGCGGGCGCCCCTGCGGG - Intergenic
1126518198 15:49558449-49558471 GGAGGGGAAGATCCCTCAGCTGG - Intronic
1128247673 15:66144059-66144081 GGAGGGGGAGACACTCCTTCTGG + Intronic
1128801800 15:70501748-70501770 AAAGGGGAAGAAGCCCCTGGAGG - Intergenic
1129210449 15:74065036-74065058 GGAGGGGAGGACGCAGGTGCAGG - Intergenic
1129858418 15:78841512-78841534 GTAGGGGAGGCCACCCCTGCAGG + Intronic
1131272837 15:90957304-90957326 GAAGGGGAAGACGATCCGGCCGG + Exonic
1132589904 16:722056-722078 GGAAGAGAAGTCGCCCCGGCCGG - Intronic
1132751128 16:1458203-1458225 GGAGAGGATGAGGCCCCTGGGGG - Intronic
1132803994 16:1767321-1767343 GGAGGGGAAGAGGCTCCTGCTGG + Intronic
1132852151 16:2029605-2029627 GGAGGGGCAGACTCGGCTGCTGG + Exonic
1132936714 16:2484928-2484950 GGAGGGGATGACGCCTCCTCCGG - Intronic
1136403660 16:30031243-30031265 GCATGGGGAGACGCCGCTGCAGG - Exonic
1138316082 16:56071602-56071624 GGAGGAGATGACCCTCCTGCTGG + Intergenic
1139953276 16:70681936-70681958 GGAGGGTCAGAAGCCCCTGTGGG - Intronic
1140597763 16:76436230-76436252 GGAGGGGATGATGCCGCTACTGG + Intronic
1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG + Intronic
1141531372 16:84648823-84648845 GGAGGGGCCGCCGCCCCCGCAGG + Intronic
1142196258 16:88740610-88740632 GGAGGGCAGGCCGCCTCTGCAGG + Intronic
1142851694 17:2707638-2707660 GGAGGAGAGGACCCCCTTGCTGG - Intronic
1142973788 17:3631025-3631047 GGAGGGGAAGACAGCACTCCCGG - Intronic
1143491956 17:7289950-7289972 CGAAGGTAAGACCCCCCTGCTGG - Exonic
1144455919 17:15418190-15418212 GGTGGGGCAGACACCCCTGTAGG - Intergenic
1144562061 17:16329065-16329087 GGAGGGAAGGAAGCCCCTGGAGG + Intronic
1144802023 17:17935930-17935952 GGAGGGGAAGACCTCCCTTCTGG - Intronic
1145056162 17:19705405-19705427 TGTGGGGAAGGCACCCCTGCAGG + Intronic
1145760205 17:27421261-27421283 GGAGGGGCAGCTGTCCCTGCTGG + Intergenic
1146063168 17:29617580-29617602 CGAGGGGATGAGGCCCATGCGGG - Exonic
1146287237 17:31582183-31582205 AGAGGGGAAGATGCCTCTGTGGG - Intergenic
1146844182 17:36173266-36173288 GGAGGGGCAGCAGTCCCTGCTGG - Intronic
1146856487 17:36261201-36261223 GGAGGGGCAGCAGTCCCTGCTGG - Intronic
1146864130 17:36327174-36327196 GGAGGGGCAGCAGTCCCTGCTGG + Intronic
1146872397 17:36385112-36385134 GGAGGGGCAGCAGTCCCTGCTGG - Intronic
1146879755 17:36436197-36436219 GGAGGGGCAGCAGTCCCTGCTGG - Intronic
1146883679 17:36457348-36457370 GGAGGGGCAGCAGTCCCTGCTGG - Intergenic
1147066990 17:37927762-37927784 GGAGGGGCAGCAGTCCCTGCTGG + Intronic
1147075281 17:37985736-37985758 GGAGGGGCAGCAGTCCCTGCTGG - Intronic
1147078522 17:38007323-38007345 GGAGGGGCAGCAGTCCCTGCTGG + Intronic
1147086806 17:38065282-38065304 GGAGGGGCAGCAGTCCCTGCTGG - Intronic
1147094460 17:38131258-38131280 GGAGGGGCAGCAGTCCCTGCTGG + Intergenic
1147102751 17:38189245-38189267 GGAGGGGCAGCAGTCCCTGCTGG - Intergenic
1147309019 17:39583179-39583201 AGAGGAGAAGACACCTCTGCCGG + Intergenic
1147357955 17:39912276-39912298 GGAGGGGAAGAAGCCCATCTTGG - Intronic
1148069938 17:44902766-44902788 GGAGGAGGAGAGGCTCCTGCAGG + Exonic
1148862103 17:50609802-50609824 TGAGGGGAAGCCGCCCCTGAGGG + Intronic
1149847324 17:60015712-60015734 GGAGGGGCAGCAGTCCCTGCTGG - Intergenic
1150085683 17:62272329-62272351 GGAGGGGCAGCAGTCCCTGCTGG - Intergenic
1150489634 17:65565343-65565365 GGAGGGGAAGTCACACCAGCTGG + Intronic
1150613822 17:66753748-66753770 GGAGGGGAAGAGGCCACAGGAGG + Intronic
1151255671 17:72874506-72874528 GGAGGGGAAAACCCCGCTGCTGG + Intronic
1151422286 17:74006350-74006372 GGAGGTGAAGGAGGCCCTGCAGG + Intergenic
1151944516 17:77312168-77312190 GGAGGGGAAGGAGCCACAGCAGG - Intronic
1152744016 17:82031047-82031069 CGAGGGGGAGACGCGCCCGCGGG - Exonic
1152930534 17:83107486-83107508 GGAGTGGAAGGTGCCCCTGCTGG + Intergenic
1156777332 18:40807866-40807888 TGATGGGAAGATGCCCCTGGGGG + Intergenic
1157194406 18:45609051-45609073 GGAGGGGAAGAAGCCCCACCAGG + Intronic
1160510738 18:79452110-79452132 GGAGGGCAAGACGCATTTGCTGG + Intronic
1160716872 19:580689-580711 CGAGGGGGAGACGGCCATGCTGG + Exonic
1160727255 19:622805-622827 GCGGAGGAAGACGCACCTGCAGG + Exonic
1160903337 19:1440151-1440173 AGTGGTGAAGACGCACCTGCGGG + Exonic
1161047761 19:2145408-2145430 GGAGGGGCAGAGTCACCTGCTGG - Intronic
1161509951 19:4664755-4664777 GGAGGGGAAGACAGACCAGCAGG - Intronic
1161663239 19:5560037-5560059 GGATAGGAAGACCCCCCTCCAGG + Intergenic
1161808690 19:6459441-6459463 GGAGGGGAGGAGGTCCCTGGGGG + Intronic
1162109297 19:8391409-8391431 GGCGGGGAAGACCCTCCAGCAGG - Intronic
1162259113 19:9518226-9518248 GGAGGGGAAGATGGCCCGGGGGG - Intergenic
1163651394 19:18520418-18520440 TGAGGCTAAGGCGCCCCTGCAGG - Intronic
1164533134 19:29063164-29063186 GGGCAGGAAGAAGCCCCTGCAGG - Intergenic
1165095305 19:33406856-33406878 GGAGGGGAAGAGGGCACTGGTGG + Intronic
1165624675 19:37273249-37273271 GGAGGGGATGAAAACCCTGCGGG + Intergenic
1165628988 19:37293466-37293488 GGAGGGGATGAAAACCCTGCGGG + Intergenic
1165941445 19:39416599-39416621 TGAGGGGCAGGAGCCCCTGCTGG + Intronic
1166352674 19:42207482-42207504 GGAGGGGAGGAGGCCCCTGGGGG - Intronic
1166524292 19:43501581-43501603 TGAGGGGCAGATGCCCCTCCTGG - Intronic
924977916 2:194961-194983 TGAGGGGAAATGGCCCCTGCAGG + Intergenic
925202503 2:1979831-1979853 GGAGAGTGAGCCGCCCCTGCAGG - Intronic
925492703 2:4412757-4412779 GGAGAGGTTGACGCCTCTGCGGG - Intergenic
927507933 2:23626725-23626747 TGCGTGGATGACGCCCCTGCAGG + Intronic
928201748 2:29251614-29251636 GAAGGGGAGAAGGCCCCTGCAGG + Intronic
932454465 2:71838856-71838878 GGAGGGGAGGACCCCCCAGAAGG + Intergenic
932689654 2:73901391-73901413 GGAGGGGAAGACAGCCCGGGGGG - Exonic
937357769 2:121209057-121209079 TGTGGGGAAGATGCCCATGCAGG + Intergenic
937895929 2:126976793-126976815 AGAGGGGGAGCTGCCCCTGCTGG + Intergenic
940057117 2:149525317-149525339 GGAGTGGCTGAAGCCCCTGCAGG + Intergenic
941986654 2:171517464-171517486 AGTGGTGAAGACGCACCTGCGGG - Intergenic
944386399 2:199169739-199169761 GGAGGGGTAGCCTCCACTGCCGG + Intergenic
946057153 2:216912344-216912366 GGAGGAGAAGGTGCCCCTCCAGG - Intergenic
946390011 2:219409439-219409461 GGAGTGGAAGGTGCCCCTGTGGG + Intergenic
947411977 2:229850809-229850831 GGAGGAGCAGCCGGCCCTGCCGG + Intronic
947638495 2:231693015-231693037 GCAGGGCAAGAGGCACCTGCAGG - Intergenic
947689031 2:232117618-232117640 GGCAGGGAAGAGGCCCCTGGTGG - Intronic
948547518 2:238743325-238743347 GGAGCGGGAGACGCCCCTAGAGG + Intergenic
948587202 2:239026891-239026913 GGCGGGGAAGACGCCCTGGCGGG - Intergenic
948790937 2:240376509-240376531 GGAGGGGAAGGCGCCCCACCTGG + Intergenic
948791048 2:240376990-240377012 GGAGAGGACGCTGCCCCTGCTGG - Intergenic
948897859 2:240935528-240935550 GGAGGGGCAGGCAGCCCTGCTGG + Intronic
948933994 2:241150543-241150565 GGAGGGTGAGCGGCCCCTGCGGG + Exonic
949004450 2:241637296-241637318 GGCGGGGGAGTCGCCCCGGCGGG + Exonic
1168979206 20:1990617-1990639 AGAGGGAAAGACGGCCTTGCAGG + Intronic
1169209538 20:3758496-3758518 GGAGGGGAAGAAGCTGCTGATGG + Intronic
1169329483 20:4705283-4705305 GAAAGTGAAGACTCCCCTGCCGG - Intergenic
1172833321 20:37855576-37855598 GGAAGAGAAGAGGCCCCTGGAGG - Intronic
1173168848 20:40706091-40706113 GGAGGGGAAGATGCAGCTCCTGG + Intergenic
1173904130 20:46613603-46613625 GGAGGGCAAGATGCCCATGAAGG + Exonic
1175237658 20:57525438-57525460 GGAGGGGAGGAGGGTCCTGCAGG + Intronic
1175237937 20:57526201-57526223 GGAGGGGAGGAGAGCCCTGCAGG + Intergenic
1175238021 20:57526425-57526447 GGAGGGGAAGAGGGCCCTCAGGG + Intergenic
1175404986 20:58720110-58720132 GGCTGGGAAGACACACCTGCAGG - Intergenic
1175625526 20:60485567-60485589 GGAGAGGAAGACCCCCTTGGGGG - Intergenic
1175910792 20:62404676-62404698 GGAGGGGGAGGCGTCCCTCCTGG - Intronic
1176187538 20:63789448-63789470 CCAGGGGAAGCCGACCCTGCAGG + Intronic
1177043824 21:16145678-16145700 GGAGGGGGTGGGGCCCCTGCTGG + Intergenic
1177774653 21:25554726-25554748 AGAGGGGAAAATGACCCTGCAGG + Intergenic
1180009965 21:45042978-45043000 GGAGGGGAAGGCCCCGCTCCAGG + Intergenic
1180177771 21:46098575-46098597 CGCGGGGAAGACGCCCCGGCTGG + Intronic
1180959473 22:19756099-19756121 GGAGGGGAAGGGGGTCCTGCTGG + Intergenic
1181419221 22:22786163-22786185 CCAGGGGAAGACCCCCCTTCAGG - Intronic
1183030389 22:35099603-35099625 TAAGGGGAAGACCCCACTGCAGG + Intergenic
1183689264 22:39379109-39379131 GGAGGTGAAGAGCCCCCTGAGGG - Intronic
1184473828 22:44710304-44710326 GGAGGGGCTGGCCCCCCTGCTGG + Intronic
1184733524 22:46384470-46384492 GGAGGGGAGGGCCCCGCTGCGGG - Intronic
1185029835 22:48436410-48436432 GTTTGGGGAGACGCCCCTGCTGG + Intergenic
950587433 3:13904509-13904531 GGAGTGGCTGAAGCCCCTGCAGG - Intergenic
954715764 3:52525979-52526001 GGAGGGGCAGAGGCCCAGGCAGG + Intronic
957689766 3:83552819-83552841 GGAGGGGAAGACTCACCCTCAGG - Intergenic
961558893 3:127715256-127715278 GGAGGTGTACACGTCCCTGCAGG + Intronic
961624959 3:128255319-128255341 GGAGGGAAGGATGCCACTGCTGG + Intronic
962201329 3:133403343-133403365 GGGGGGGAAGAGGCAGCTGCAGG - Intronic
965996136 3:174885030-174885052 GGAGGGGATGTTGCCTCTGCTGG + Intronic
966079205 3:175978481-175978503 GGATGGGAAGACGGCCCCGGAGG + Intergenic
968437204 4:599923-599945 GGAGTGGCTGAAGCCCCTGCAGG + Intergenic
968842479 4:3017610-3017632 GGAGGAGAGGAGGCCCCAGCCGG - Intronic
969300471 4:6294251-6294273 GGAGGGAATGAGGCCCCTGAAGG - Intronic
969505909 4:7587646-7587668 GGAGGCGAAGACGCTGCTGTGGG - Intronic
972805628 4:42527441-42527463 AGAGGGGAAGTTGCCCCTACTGG - Intronic
976211974 4:82680814-82680836 GGAGAAGAAGAAGCCCCGGCGGG + Exonic
980954092 4:139410658-139410680 GGAGAGGAAGAAACCCTTGCAGG + Intronic
981751804 4:148099413-148099435 GGAGGGAAAGAAGCACCTGAGGG - Intronic
985621996 5:960686-960708 GGTGGGGAGGAGGCCTCTGCAGG - Intergenic
986334457 5:6743087-6743109 GCAGGGGCAGACGCACCTCCGGG + Intronic
986518342 5:8586800-8586822 GGAGGGGCAGCTGCCACTGCTGG - Intergenic
986651185 5:9964666-9964688 GGAGGGGAACAGGCACCTGCAGG + Intergenic
988350989 5:30106787-30106809 GGAGTGGAATTTGCCCCTGCTGG + Intergenic
990450474 5:55928160-55928182 GGAGGGGAAGACGCCAGGGCAGG + Intergenic
990624710 5:57598114-57598136 GCAGGGGAAGATGCGCCAGCAGG + Intergenic
992543210 5:77784963-77784985 GGAGGGGAAGACTGCCCGGGCGG - Intronic
994291732 5:98034575-98034597 GGAGGGGATGTTGCCACTGCTGG + Intergenic
994958123 5:106561738-106561760 GGAGGGGATGTTGCCCCTACTGG - Intergenic
997521620 5:134527172-134527194 GGCCGGGAAGATGCCACTGCCGG - Intronic
999101622 5:149030128-149030150 GGAGGGGTACACGCCCCTCTTGG + Intronic
999282043 5:150372379-150372401 GGAGTGCAAGACTCCCCTGTGGG - Intronic
999445104 5:151632881-151632903 GAAGGGGAAGCCTTCCCTGCAGG - Intergenic
1000712761 5:164601196-164601218 AGTGGTGAAGACGCACCTGCGGG - Intergenic
1003107740 6:3228464-3228486 GGAGTGCATAACGCCCCTGCTGG + Intronic
1003381044 6:5624951-5624973 TGAGGGGCAGACTCCCATGCTGG - Intronic
1003418024 6:5930366-5930388 GGAGGAGAAGTGGCCCCTGGGGG - Intergenic
1006806597 6:36793239-36793261 GGAAGGGAAGCCGGCCCTGGAGG + Intronic
1007558008 6:42782780-42782802 CGAGGGGAAGACGGCGCGGCGGG + Intronic
1008659557 6:53652143-53652165 GCAGCCGAAGACGCCCCTGGAGG - Exonic
1013805308 6:113989899-113989921 GGAGGTGAAGAAGTGCCTGCTGG + Intronic
1017153902 6:151305899-151305921 AGAGGGTAAGCCGCCCCTCCAGG + Exonic
1017466257 6:154696717-154696739 GGAGTGGAAGATGCCTGTGCTGG + Intergenic
1019038518 6:169083292-169083314 GATGGGGAAGAAGGCCCTGCCGG - Intergenic
1019318951 7:406158-406180 GGATGGGAGGACCCCCTTGCTGG - Intergenic
1019497293 7:1346506-1346528 GGAACGGAAGCCGCCCCTTCCGG - Intergenic
1019724364 7:2593025-2593047 GGAGGTGAAGCAGCTCCTGCAGG + Exonic
1020125192 7:5529559-5529581 GGAGGGGAAGACGGCCCGGGGGG + Exonic
1022941663 7:35247441-35247463 GGCTGGGAAGACGCCCTTTCTGG + Intronic
1023025493 7:36046110-36046132 GGAGGGGCAGAAGGCCTTGCTGG + Intergenic
1023850804 7:44149301-44149323 GGTGTGGAAGACCCCTCTGCTGG + Intronic
1023943766 7:44787206-44787228 GGCGGGGAGGATGCACCTGCTGG - Intergenic
1024268653 7:47625845-47625867 GGAGGGGAGGCCACCCCTTCTGG + Intergenic
1024604662 7:51013716-51013738 GGCTGGGAGGACGGCCCTGCTGG + Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1031978033 7:128106034-128106056 GGAGGGGACGGAGCCCCTCCTGG + Intergenic
1035371010 7:158379015-158379037 GGAGGGGAAGAGCTCCCTGCAGG + Intronic
1035699111 8:1624676-1624698 GGAGGGGACAGGGCCCCTGCTGG + Intronic
1036646986 8:10617100-10617122 GGAAGGGAAGGGGTCCCTGCAGG - Intronic
1036930432 8:12951418-12951440 GTAGGAGAAGACGCCCCGGCGGG - Intronic
1038916623 8:32031447-32031469 GGAGGGGCAGCTGCCCGTGCGGG - Intronic
1039212727 8:35235418-35235440 GGAGGGGAAGGGGCGGCTGCGGG + Intergenic
1040581419 8:48701655-48701677 GGAGGGAAAGAGGCCAGTGCAGG + Intergenic
1040587635 8:48758025-48758047 AGAGGGGAAGCCCCTCCTGCTGG - Intergenic
1045582944 8:103499851-103499873 GGAGGTGACGCCGCCCCCGCGGG + Intergenic
1047375785 8:124294821-124294843 GGAGGGGAAGACCCACCCTCAGG + Intergenic
1047615351 8:126558274-126558296 GGAGGGGCAGCAGCCCCAGCTGG - Exonic
1049978428 9:882146-882168 GGAGAGGCAGAAACCCCTGCAGG + Intronic
1050740536 9:8814401-8814423 GGAGGGGAAGACCCCACAGAAGG + Intronic
1052991771 9:34522884-34522906 GGAGCGGACGTCGCCTCTGCTGG - Exonic
1055686816 9:78783957-78783979 GGAAGAAAAGAGGCCCCTGCTGG - Intergenic
1055760182 9:79598728-79598750 GGAGGGGAAGAAAACCCTTCTGG - Intronic
1056435407 9:86571028-86571050 GGAGGGGAAGACCCACCTTCAGG + Intergenic
1061028696 9:128067008-128067030 GGAGCTGAAGAAGCACCTGCTGG - Exonic
1061181539 9:129027790-129027812 GGAGGGGAGGAGGCACCGGCTGG - Intronic
1061937635 9:133867065-133867087 GCAGGAGGACACGCCCCTGCAGG + Intronic
1062161072 9:135080245-135080267 GGAGGGGAAGAGGGCCTGGCAGG - Intronic
1062577502 9:137215471-137215493 GGAGGAGCAGAGGCCCCGGCGGG - Exonic
1185467574 X:363728-363750 AGACGGGAAGGCGCCGCTGCGGG - Intronic
1188380767 X:29488853-29488875 GGTGGGGGAGACGCCCCTTTGGG + Intronic
1189861407 X:45276168-45276190 GGAGTGGCTGAAGCCCCTGCAGG + Intergenic
1192960683 X:76127259-76127281 GGAGTGGCTGAAGCCCCTGCAGG - Intergenic
1193749692 X:85326774-85326796 GGAGGGGAAGCAGCCCCCGTGGG - Intronic
1196130658 X:112151899-112151921 GAAGGGGAAGTAGCCCCTGTGGG + Intergenic
1197428104 X:126323376-126323398 GGAGTGGCTGAAGCCCCTGCAGG - Intergenic
1199996637 X:153030371-153030393 GAAGGTGAAAATGCCCCTGCAGG + Intergenic
1201416136 Y:13751344-13751366 GGAAGGTAGGACGCCCCTGGCGG + Intergenic