ID: 1141033936

View in Genome Browser
Species Human (GRCh38)
Location 16:80612127-80612149
Sequence GGAGGGGAAGACGCCCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141033929_1141033936 11 Left 1141033929 16:80612093-80612115 CCAGAAGCTGAGTCATGGCCAAT 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 280
1141033926_1141033936 30 Left 1141033926 16:80612074-80612096 CCCTTGCAGGCGCATGTGACCAG 0: 1
1: 1
2: 0
3: 6
4: 80
Right 1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 280
1141033933_1141033936 -7 Left 1141033933 16:80612111-80612133 CCAATACCACATGAGTGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 280
1141033927_1141033936 29 Left 1141033927 16:80612075-80612097 CCTTGCAGGCGCATGTGACCAGA 0: 1
1: 1
2: 1
3: 5
4: 88
Right 1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141033936 Original CRISPR GGAGGGGAAGACGCCCCTGC CGG Intronic