ID: 1141035260

View in Genome Browser
Species Human (GRCh38)
Location 16:80620715-80620737
Sequence GTAATCCTACGCAGGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141035258_1141035260 -7 Left 1141035258 16:80620699-80620721 CCTGTATTTTTACTTGGTAATCC 0: 1
1: 0
2: 2
3: 41
4: 351
Right 1141035260 16:80620715-80620737 GTAATCCTACGCAGGACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 43
1141035256_1141035260 27 Left 1141035256 16:80620665-80620687 CCTGGTTGTTTGAAATTCGAATT 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1141035260 16:80620715-80620737 GTAATCCTACGCAGGACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141035260 Original CRISPR GTAATCCTACGCAGGACCCC AGG Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
902183485 1:14707588-14707610 GTAATGCTACAGAGGAGCCCGGG + Intronic
904799948 1:33085596-33085618 GTCATCCTGCCCAGGACTCCAGG - Intronic
907355605 1:53870750-53870772 GTAATCCTACCTAGCACCTCGGG + Intronic
909988009 1:82186212-82186234 GTTCTCCTGCCCAGGACCCCAGG - Intergenic
915740490 1:158115146-158115168 ATAATTCTACACAGGACCCCTGG - Intergenic
1074947903 10:118299021-118299043 GTAATCCTTCTCTGGCCCCCTGG + Exonic
1078151576 11:8764101-8764123 GTAATCCTACTCAGGAGGCTGGG + Intronic
1081416398 11:42821307-42821329 GTGATCCTCAGGAGGACCCCTGG - Intergenic
1084688230 11:70709887-70709909 GACATCCTACCCTGGACCCCCGG - Intronic
1091533172 12:1379682-1379704 GTAACCCTACAGAGGACCCCGGG - Intronic
1107723839 13:43277433-43277455 GTAATGATAGGCATGACCCCAGG - Intronic
1122512261 14:102279116-102279138 GTAACCCTACACTGAACCCCGGG + Intronic
1126841969 15:52725866-52725888 TTAATCCTACTGAGGAACCCTGG - Intergenic
1130406837 15:83610091-83610113 TAAATCCTACGCAGATCCCCAGG - Intronic
1130927231 15:88394763-88394785 GTAATCCTACCCAGCACCCAAGG + Intergenic
1141035260 16:80620715-80620737 GTAATCCTACGCAGGACCCCAGG + Intronic
1141829263 16:86500552-86500574 GTGGTCCCAGGCAGGACCCCAGG + Intergenic
1142235742 16:88921682-88921704 GTCACCCTAAACAGGACCCCTGG + Intronic
1149693573 17:58598709-58598731 GGCATCCTAAGCAGGACCCCAGG - Intronic
1158377987 18:56894183-56894205 GGAAGCCTTCGCAGGAACCCGGG - Intronic
1160056956 18:75492313-75492335 TTAAACCTACTCAGGGCCCCAGG + Intergenic
1166311808 19:41967251-41967273 CTCATCCTGCGCAGGAACCCAGG - Exonic
934196548 2:89841664-89841686 GTAATACTCCCCAGAACCCCAGG + Intergenic
934861555 2:97767766-97767788 GTGATACTACTCAGGACTCCCGG + Intronic
936547481 2:113405041-113405063 GTAATACTCCCCAGAACCCCAGG + Intergenic
1171977947 20:31607179-31607201 CAGATCCTACGCAGGAGCCCCGG - Intergenic
1173890072 20:46500349-46500371 GTAATCCTAATCAGCATCCCAGG + Exonic
1176180008 20:63745388-63745410 GTACTCCTCCACAGGACCCCCGG + Exonic
1180590772 22:16935393-16935415 GTAATACTCCCCAGAACCCCAGG - Intergenic
949426202 3:3918839-3918861 GTAATCCTACAAATGATCCCAGG + Intronic
949627758 3:5887214-5887236 GTAATCCAGGGCAGGACCCCTGG - Intergenic
960377064 3:116916086-116916108 GGAATCTTACGCAGTATCCCTGG + Intronic
963570368 3:146987263-146987285 GAAATCCTAGGAAGGAGCCCTGG + Intergenic
967814790 3:193789400-193789422 GGAATCCAACCCAGGACCACTGG + Intergenic
973012241 4:45091470-45091492 GTAATCCTAAGCAGTATCTCTGG + Intergenic
974387714 4:61224750-61224772 GAAATCCTTGGCAGGACCCGAGG + Intronic
974477475 4:62402486-62402508 GTAATCCTGCTGAGGACCCTTGG + Intergenic
976520135 4:86017242-86017264 GGAAGCCTCGGCAGGACCCCTGG - Exonic
987014317 5:13801697-13801719 GCAATCCTCCTCAGGACTCCAGG + Intronic
991389707 5:66129357-66129379 GTAATCCTGCTCAGTACTCCAGG - Intergenic
1002173052 5:177385983-177386005 CTAGTCCTACACAGGATCCCGGG + Exonic
1020286661 7:6686982-6687004 GTAATCCTACTCAGGAGGCTGGG + Intergenic
1022762443 7:33370132-33370154 ATAATCCTACTCAGTTCCCCAGG - Intronic
1028987746 7:97021389-97021411 GTAAGCCTGCGCAGGACGCGCGG + Intronic
1038776017 8:30531290-30531312 GTAATCCAACACAGGAACCAAGG - Intronic
1040328753 8:46375365-46375387 GTCATCCTGGGCAGGACCTCGGG + Intergenic
1044820661 8:96153796-96153818 TTTCTCCTGCGCAGGACCCCTGG - Intronic
1055115099 9:72597559-72597581 TTATTCCTACTCAGGACCCAGGG - Intronic
1060282795 9:122225566-122225588 GTAATCCCACTCAGGGCTCCGGG + Intronic