ID: 1141037155

View in Genome Browser
Species Human (GRCh38)
Location 16:80637556-80637578
Sequence ACTAATAAGCAAATACTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 376}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141037155 Original CRISPR ACTAATAAGCAAATACTGTA AGG Intronic
902393602 1:16120154-16120176 ATTAATTAGCAAATTCTGGAGGG - Intergenic
904721219 1:32510299-32510321 ACTCAGAAGCAAACACTGCAAGG - Intronic
904967485 1:34387946-34387968 ACTAATAAGCAATTATAGCAAGG + Intergenic
906455346 1:45991726-45991748 ACTAATAAGCAATTACAACAAGG - Intronic
907315248 1:53566366-53566388 ACTAATAAGCAATTATAGCAAGG + Intronic
907881979 1:58558408-58558430 ACTAATAAGCAATTAAAGCAAGG + Intergenic
909381218 1:75000857-75000879 ACAAAAGAGCAAATATTGTATGG - Intergenic
909758813 1:79263527-79263549 AGTAATAAGCAAAGACTTTCTGG + Intergenic
911595518 1:99794589-99794611 AATAATAAAAAAATACTTTAGGG - Intergenic
911813179 1:102310356-102310378 AGTAATAAGCAATTATTGTAAGG + Intergenic
911991473 1:104703348-104703370 ACTGATAAGCAAATTCGGAAAGG + Intergenic
912168353 1:107067385-107067407 AAAAATAAGCAAATACTTAAGGG - Intergenic
912800370 1:112716106-112716128 ATAAATAACCTAATACTGTATGG - Intergenic
913028144 1:114867619-114867641 ACTAATAAGCAATTACAGCAAGG - Intronic
915767675 1:158382039-158382061 ACAAATAATCAAATACTGGGTGG + Intergenic
916805489 1:168256196-168256218 ACTAGTAAGCAATTATAGTAAGG - Intergenic
916912052 1:169361481-169361503 ACTAAAAAGCAGATGCTGTCTGG + Intronic
917363925 1:174208234-174208256 ACTAATAAGCAAGTACAGTAAGG - Intronic
917947069 1:179985243-179985265 ACAAAAAGACAAATACTGTATGG - Intronic
918493468 1:185108307-185108329 ACTAATAAGTAAATTCAGCAAGG + Intergenic
918912703 1:190594222-190594244 ACTAAAAAGCAAATGTGGTATGG + Intergenic
918915395 1:190629877-190629899 ACTGATAAGCAAATTCAGTAAGG - Intergenic
918948352 1:191100319-191100341 AATAATAAGCAAATATAGAAAGG + Intergenic
918997261 1:191778200-191778222 ACTAATAAACAAATTCAGAAAGG + Intergenic
919016813 1:192048919-192048941 GCTAATGAGCAAATATTTTATGG + Intergenic
919186565 1:194158954-194158976 ACAAATAAACAAATTCAGTAAGG - Intergenic
919274210 1:195391583-195391605 ACTGATAAACAAATTCAGTAAGG - Intergenic
919961918 1:202479459-202479481 ACTAATCAGCAAATACCTCAAGG - Intronic
920022393 1:202966282-202966304 AGTAATTAGCAAATCCTGCAGGG + Intronic
920778543 1:208965228-208965250 ACTGATAAGCAAATTCAGTAAGG - Intergenic
921139115 1:212288404-212288426 ACTAGTGACCAAATACTATATGG - Intronic
921438146 1:215151703-215151725 AATAATATGAAAGTACTGTATGG - Intronic
922181459 1:223237209-223237231 ACTAATAAGCAATTATAGCAAGG - Intronic
922392771 1:225163219-225163241 ACTGATAAACAAATTCGGTAAGG - Intronic
923023092 1:230180967-230180989 ACTAATAAACAATTACAGCAAGG - Intronic
923322649 1:232850419-232850441 ACTAATAAGTGAGTTCTGTAAGG - Intergenic
923367394 1:233276218-233276240 ACGAACAAGCAAATTCTGCATGG + Intronic
924183077 1:241458737-241458759 ACGAATAAGCAGAAACTATAAGG + Intergenic
1063807487 10:9662446-9662468 ACTAATAAGCAAATATAGCGAGG - Intergenic
1065526476 10:26626825-26626847 ACTAATAAGCAGTTACAGCAAGG - Intergenic
1067320344 10:45213785-45213807 ACTAATAAACAACTACAGCAAGG + Intergenic
1069248401 10:66238134-66238156 AATAAAAAGCAAAAACTATAGGG - Intronic
1071975089 10:90947595-90947617 ATAAACAAGCAAATACTGCATGG + Intergenic
1071998405 10:91169412-91169434 ACTAATAAGCAATTACAGCAGGG + Intronic
1073253182 10:102134101-102134123 ACTAATAAGGCAAGACTGCAAGG - Intronic
1074418669 10:113289797-113289819 ACTAATAAGGAAACTCTGCAAGG - Intergenic
1075536998 10:123279607-123279629 ATTAGTATCCAAATACTGTATGG + Intergenic
1075749743 10:124756294-124756316 AGTAATTTGCAAATACTTTAGGG + Intronic
1077136638 11:1002850-1002872 CCTAAGAAGCAAATGCTGCACGG - Intronic
1078403777 11:11050005-11050027 ACTAATAAGCATATTCAGCAAGG - Intergenic
1078805600 11:14697903-14697925 ACGAATAAGCAAATTTAGTAAGG - Intronic
1079192346 11:18290487-18290509 ACTAATACAGAAATACTATATGG - Intronic
1081647675 11:44801103-44801125 ATAAATAAGCAAATGCTCTAAGG - Intronic
1081834122 11:46139824-46139846 ACTAAACAGCTAATATTGTATGG - Intergenic
1083133639 11:60650649-60650671 ACTAATAAGCAAATTCAGTAAGG - Intergenic
1085574930 11:77593958-77593980 ACAAAAAGACAAATACTGTATGG + Intronic
1085753291 11:79181730-79181752 ACTAATAAGCAATTATAGCAAGG + Intronic
1085852775 11:80140955-80140977 AATACCAAGCAAATACTGTCAGG + Intergenic
1086172702 11:83854008-83854030 ACTAATAAGCAATTAGAGCAAGG + Intronic
1087805236 11:102548140-102548162 AATAAAAAGCAAACACTGTGAGG - Intergenic
1090247574 11:125227466-125227488 ACAAAAAGACAAATACTGTATGG - Intronic
1091081776 11:132677029-132677051 ACTAATAAGCAATTATAGCAAGG + Intronic
1091438338 12:492251-492273 ACTAATAAGCAAGTATAGAAGGG + Intronic
1091454282 12:594229-594251 ACTAATAAGCAAGTATTACAAGG + Intronic
1091462504 12:655396-655418 ACTAATAAGCAATTATAGCAAGG + Intronic
1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG + Intronic
1093243228 12:16703393-16703415 AATAATAAGCCAATAAGGTAGGG - Intergenic
1093324368 12:17756252-17756274 ACTGATAAACAAATTCAGTAAGG - Intergenic
1093616305 12:21229726-21229748 ACTAATAAGCAATTATTGCAAGG - Intronic
1093900819 12:24629956-24629978 ACTAATAAGCAATTATATTAAGG - Intergenic
1094645442 12:32318995-32319017 ACTAATAAGCAAGTATAGCAAGG - Intronic
1095564631 12:43608138-43608160 ACTAATAAACAAAATCAGTAAGG - Intergenic
1095656552 12:44676398-44676420 ACAAATAAGCTAACACTGAAAGG + Intronic
1096039835 12:48504820-48504842 ACTAACAAGCAATTATTGCAAGG + Intergenic
1098844065 12:75513603-75513625 ACTATTAATCATATACTGAAGGG + Intergenic
1099026641 12:77472557-77472579 ACTAATAAACAAATACAGTAAGG + Intergenic
1099412906 12:82353388-82353410 ATTACTAAGCAAACACTCTAAGG + Intronic
1099551783 12:84054824-84054846 GCTAATAAACAAATTCAGTAAGG - Intergenic
1099794472 12:87381577-87381599 ACTAATAAGTATATACAGTCAGG + Intergenic
1099824617 12:87758933-87758955 AAAAATTAGGAAATACTGTAAGG - Intergenic
1100220455 12:92499359-92499381 ACAAATAAGCAAATATTCTTAGG - Intergenic
1102728810 12:115089821-115089843 ACCAAGAAACAAAAACTGTAAGG + Intergenic
1104263808 12:127211915-127211937 ATTAATGAGTAAATACGGTACGG + Intergenic
1105670179 13:22604856-22604878 ACCAATAAGCAATTATTGCAAGG + Intergenic
1105671397 13:22620488-22620510 ACTAATAGGCAATTACAGCAAGG - Intergenic
1106767443 13:32927929-32927951 ACTAATAAGCGAATTTAGTAAGG - Intergenic
1106994842 13:35469855-35469877 TCAAATAACCAAGTACTGTATGG + Intronic
1108014813 13:46063411-46063433 ACAGAAAATCAAATACTGTATGG - Intronic
1108294086 13:48995261-48995283 ACTTCTAACAAAATACTGTAAGG + Intronic
1108911322 13:55555457-55555479 ACAAACAAGCAAAAACTGTAAGG - Intergenic
1109177166 13:59170793-59170815 AATGATAAGAAAATACTGTTGGG + Intergenic
1109212761 13:59553372-59553394 ACTGATAAACAAATTCAGTAAGG + Intergenic
1109576997 13:64272527-64272549 ACTATCAAGAAAATATTGTAAGG - Intergenic
1109679902 13:65737281-65737303 ACTGATAAACAAATTCAGTAAGG + Intergenic
1109895555 13:68683654-68683676 ACTAATTAGGAATTAATGTAAGG + Intergenic
1111129156 13:83952161-83952183 AATAATAAGCAATTACAGTAAGG + Intergenic
1111289220 13:86141429-86141451 ACTCTAAATCAAATACTGTAGGG - Intergenic
1111429363 13:88132124-88132146 ACTAATAAGCAATTACGGCAAGG + Intergenic
1111817348 13:93170168-93170190 ACTCATCAGGAAATACTGGAAGG + Intergenic
1112136812 13:96588110-96588132 AATAATAAGCAAATTCAGTAAGG - Intronic
1112535473 13:100249923-100249945 ACTGATAAGCAATTATAGTAAGG - Intronic
1112823375 13:103362357-103362379 ACTAATAAACAAATTCAGTGAGG - Intergenic
1115678336 14:35707204-35707226 ACTAATAAGCAATTATAGCAAGG - Intronic
1116310804 14:43324405-43324427 TCAAATAAATAAATACTGTAGGG + Intergenic
1116834459 14:49756763-49756785 ACTAATAAGCAATTATAGCAAGG - Intergenic
1117363974 14:55006492-55006514 ACTAATAAGAAAATTTAGTAAGG - Intronic
1117786861 14:59294821-59294843 AACAATAAGCAAATACAGCATGG - Intronic
1117926944 14:60791171-60791193 ACTAACAAGCAAATAATATAAGG - Intronic
1118216925 14:63817647-63817669 ACTAAAAAAGAAAAACTGTATGG + Intergenic
1118268439 14:64318129-64318151 ACTAATAAACAATTACAGCAAGG + Intronic
1119059095 14:71456606-71456628 AATAATAAGCCAACACTATAAGG - Intronic
1119089591 14:71768998-71769020 ACTAATAAGCAAGTTCTGCAAGG + Intergenic
1120374584 14:83686367-83686389 TCTAATAAGGAAATAGTGTCTGG + Intergenic
1120837217 14:89051587-89051609 ACTAATCAGCAATTACAGCAAGG + Intergenic
1122182158 14:99963679-99963701 ACTAATAAACAAGTTCTGCAAGG - Intergenic
1122359010 14:101147011-101147033 ACTTATAAACAAATTCAGTAAGG - Intergenic
1123390185 15:19863413-19863435 AATAAGAAATAAATACTGTATGG - Intergenic
1123461948 15:20480629-20480651 ATTTATAAACAAATACTGGAGGG + Intergenic
1123656108 15:22519757-22519779 ATTTATAAACAAATACTGGAGGG - Intergenic
1124050797 15:26196024-26196046 TCCAAGAAGCAAATACTGTTTGG + Intergenic
1124272634 15:28296612-28296634 ATTTATAAACAAATACTGGAGGG + Intronic
1124310018 15:28614929-28614951 ATTTATAAACAAATACTGGAGGG - Intergenic
1128598892 15:68978559-68978581 ACTAATAAGCAAGTGTAGTAAGG - Intronic
1128909513 15:71499743-71499765 ACCAAAAGACAAATACTGTATGG - Intronic
1129026654 15:72581680-72581702 TCTTATAAGAAAACACTGTATGG - Intronic
1129374314 15:75118555-75118577 ACTAATAAGCAAATGTAGCAGGG - Intergenic
1135359237 16:21797244-21797266 ACAGAAAAACAAATACTGTATGG - Intergenic
1135457788 16:22613681-22613703 ACAGAAAAACAAATACTGTATGG - Intergenic
1135501286 16:22998227-22998249 ATAAATAAGTAAATACTATAAGG + Intergenic
1135849059 16:25946028-25946050 AGTATTAAGCAAAGACTGTCTGG - Intronic
1140189865 16:72806217-72806239 GCTCAAAAGAAAATACTGTAGGG + Intronic
1140643093 16:77000093-77000115 ACCAAATAGCACATACTGTATGG + Intergenic
1141037155 16:80637556-80637578 ACTAATAAGCAAATACTGTAAGG + Intronic
1141458622 16:84162522-84162544 CCTAAAAAGGAAATACTGGATGG + Intronic
1143686275 17:8518505-8518527 ACTATAAAGCAACTTCTGTAAGG + Intronic
1143774635 17:9190035-9190057 ACTAATAAGAGAATTCTATAAGG + Intronic
1144035125 17:11358281-11358303 ACAAAAAGACAAATACTGTATGG - Intronic
1144392606 17:14809546-14809568 ACTAATAAGTAAATTTAGTAAGG + Intergenic
1144466384 17:15500846-15500868 AATAATAAGCATATATTGCATGG - Intronic
1144512899 17:15892581-15892603 ACTAATTAGAAAATGCTGTATGG - Intergenic
1146139625 17:30354194-30354216 ACTAATAAACAAGTTCAGTAAGG - Intergenic
1147519177 17:41152739-41152761 ACTAATAAACAAATTCAGTAAGG - Intergenic
1149951155 17:60987692-60987714 ACTGATAAACAAATTCAGTAAGG - Intronic
1150038351 17:61829469-61829491 ATTAATTAGAGAATACTGTAAGG - Intronic
1150310282 17:64122718-64122740 CCTATTAAGCAAAGACTGGAAGG + Intronic
1153751369 18:8234442-8234464 ACTAATAAGCAAATGTAGCAAGG - Intronic
1154020108 18:10656924-10656946 ACTAATAAGAGAATACAGCAAGG - Intergenic
1154232202 18:12567101-12567123 ACTAATAAGCAATTATAGCAAGG + Intronic
1155013799 18:21811603-21811625 ACAAAAAGACAAATACTGTATGG + Intronic
1155391657 18:25344311-25344333 AGTATTAATCAAATAGTGTAAGG - Intronic
1155904502 18:31433333-31433355 ACTAATAAGCAATTACAGGAAGG + Intergenic
1156076991 18:33290934-33290956 ATTAATAAGAAATTAATGTATGG - Intronic
1157962977 18:52177771-52177793 ATAAATAAATAAATACTGTATGG - Intergenic
1157989902 18:52482412-52482434 ACAAATTACCAAATACTATATGG + Intronic
1158469089 18:57719132-57719154 ACTGGTAAACAAATTCTGTAAGG + Intronic
1158650840 18:59283908-59283930 ACTAATAAACAAATTCAGTAAGG - Intronic
1158858637 18:61570084-61570106 ACTATTGAGCACCTACTGTATGG + Intergenic
1159144121 18:64431485-64431507 ACAAAAGAACAAATACTGTATGG - Intergenic
1160176198 18:76596861-76596883 AATAATATGAAAATACTGAAAGG + Intergenic
925701445 2:6642685-6642707 ACTAATAAGCAATTATAGCAAGG + Intergenic
926331039 2:11825374-11825396 ACTAGTCAGCAAATACTGTAAGG - Intronic
928192801 2:29188893-29188915 TCTAATATGTAAATATTGTAGGG + Intronic
929576119 2:43053640-43053662 ACAAAAGAGCACATACTGTATGG - Intergenic
930607482 2:53507585-53507607 TCTAATCAGCAAATCCTCTAGGG + Intergenic
931017217 2:57997086-57997108 AATAAGAAGCAAATTCAGTAAGG + Intronic
933638654 2:84735141-84735163 ACAGAAAACCAAATACTGTATGG - Intronic
933875876 2:86622125-86622147 TCTGAAAAGCTAATACTGTACGG + Intronic
935463275 2:103364241-103364263 AGTAGTCAGCAAAAACTGTAAGG - Intergenic
935601229 2:104923893-104923915 ACAAAAAGACAAATACTGTACGG + Intergenic
936697602 2:114968844-114968866 AGTAATAGGCAAATATTGTCAGG - Intronic
937065818 2:119016699-119016721 TCTTATCAGTAAATACTGTAAGG - Intergenic
938022189 2:127915175-127915197 ACAAACAAACAAAAACTGTATGG - Intergenic
939087428 2:137738228-137738250 AGTACTAAACAAAAACTGTAGGG - Intergenic
939834805 2:147116182-147116204 ACTAAAAAAGAAATGCTGTATGG - Intergenic
939904054 2:147888636-147888658 ACTAATAAGCGAATTAAGTAAGG - Intronic
940013733 2:149081826-149081848 ACTAAAAAGTACATACTCTAGGG - Intronic
940399043 2:153225611-153225633 ACTAATAAATAAATACAGCAAGG + Intergenic
940671065 2:156668540-156668562 ACAAATAAGCAATTGTTGTAAGG - Intergenic
940845321 2:158634820-158634842 TCTAATAAGCAAAAAGTGTTTGG + Intronic
940927688 2:159384685-159384707 ACTGATAAATAAATACTCTATGG + Intronic
941212506 2:162658832-162658854 ACTAATAAGCAATTATAGTAAGG - Intronic
941224278 2:162826938-162826960 ACTTTTAAGCAAATTCTGTATGG - Intronic
942818263 2:180078808-180078830 ACTAAGAAGAAAGTTCTGTAGGG - Intergenic
942940717 2:181612496-181612518 ACAAAGAAGCACATACTTTATGG - Intronic
943194851 2:184732886-184732908 ACTAATAGGCAATTACAGCAAGG - Intronic
943357720 2:186878435-186878457 ACTAATAAGCAAATTCAGTAAGG - Intergenic
943710433 2:191088198-191088220 ACTAATAAGCCATTAGAGTAAGG + Intronic
943848895 2:192690219-192690241 ATTATTAAGCTAATACTTTATGG + Intergenic
944072585 2:195689802-195689824 ACAAAAAGGCAAATAATGTATGG - Intronic
944155711 2:196605383-196605405 ACAAAAAAGCATATATTGTATGG + Intergenic
944450833 2:199840746-199840768 GCTAAAAATCACATACTGTAGGG - Intronic
944790305 2:203118020-203118042 ACTAATAAGCAAATTTTATTAGG - Intronic
945764751 2:213961265-213961287 ACTAATAAACAAATTCAGCAAGG - Intronic
945814408 2:214586631-214586653 TGTAATATTCAAATACTGTAAGG - Intergenic
947755754 2:232563455-232563477 ACAAATAAGCATATACTTGATGG + Intronic
1168762411 20:358235-358257 ACTATTAATAAAATACGGTAAGG + Intronic
1169430787 20:5534318-5534340 ATTCATTAGCAAATCCTGTAGGG - Intergenic
1170026439 20:11893353-11893375 GCTATCAAGCAAATCCTGTAAGG + Intronic
1170388392 20:15845795-15845817 AATAATAGACCAATACTGTAGGG - Intronic
1170611121 20:17914409-17914431 ACAAAAAGACAAATACTGTATGG + Intergenic
1170751519 20:19151938-19151960 ATAAATAAGCAATTACAGTAAGG + Intergenic
1171384508 20:24760922-24760944 ACTAATAAGCAATTACAGCAAGG + Intergenic
1172866526 20:38103618-38103640 ACTAATAAGCAAGTTCAGCAAGG + Intronic
1172879070 20:38186545-38186567 ACTAATAAACAAATTCAGCAAGG - Intergenic
1172957828 20:38773848-38773870 ACAAAACAACAAATACTGTATGG - Intergenic
1173745811 20:45436070-45436092 AGTGAAAAGTAAATACTGTATGG - Intergenic
1176200922 20:63860196-63860218 ACAAATAAACAAATACTTTTTGG - Intergenic
1177314450 21:19438663-19438685 ACTAAAAGGCAGATATTGTAAGG + Intergenic
1177351329 21:19945746-19945768 GCTAATAAGCAAATTCAGCAAGG - Intergenic
1177965451 21:27721112-27721134 ACAAATGAGCAAATCCTGGATGG + Intergenic
1178989384 21:37339958-37339980 ACTAATAAGGAAATATTTTCAGG + Intergenic
1180517699 22:16163223-16163245 ACTACAAAGAAAATAATGTAGGG - Intergenic
1181583504 22:23840747-23840769 ACAAAAAGACAAATACTGTATGG + Intergenic
1182824277 22:33250381-33250403 ACTAATAAGCAATTAGAGCAAGG - Intronic
1182959913 22:34462590-34462612 TCTAATTAGTAAATAATGTAGGG - Intergenic
1184494786 22:44832615-44832637 ACTAATAAACAAGTTCAGTAGGG - Intronic
1184969833 22:48009655-48009677 ACTAATAAGCAATTATAGCAAGG - Intergenic
949583006 3:5409945-5409967 ACTAAACAGTAAATTCTGTATGG - Intergenic
949621688 3:5820010-5820032 ACTATTAAGAAAATACTGGGGGG + Intergenic
949648205 3:6123442-6123464 CCTATTAAACAAATTCTGTAAGG - Intergenic
949893537 3:8752202-8752224 ACTAATAAGCAAGTTCCGCAAGG - Exonic
950183274 3:10929686-10929708 ACTCATAGGTAAATGCTGTAGGG - Intronic
950209159 3:11105716-11105738 ACCAATAAACAAATTCAGTAAGG - Intergenic
951070602 3:18324476-18324498 ACTAATAAGTAAATTTTGAAAGG - Intronic
951645616 3:24887728-24887750 ACTGAAAGGCAAATACTGAAAGG - Intergenic
951760196 3:26139101-26139123 TCTAATCAGCAAAGACTGCAGGG - Intergenic
952174665 3:30848833-30848855 ACTAATCAGCAACTACTGCGTGG + Intronic
952442947 3:33351297-33351319 ACTAATTAGCAATTATAGTAAGG + Intronic
952867978 3:37869704-37869726 ACTAATGATAAAATACTGAATGG - Intronic
954087221 3:48254828-48254850 ACTAATAAGCAAACATAGAAAGG - Intronic
954879850 3:53826871-53826893 ACTAATAAGCAATTATAGCAAGG + Intronic
954893004 3:53948821-53948843 ACTAATAAACAAATATAGTAAGG + Intergenic
955127400 3:56126953-56126975 ACTAATCACCAAATTCAGTAAGG + Intronic
956439083 3:69262425-69262447 TGTAATAATCAAATACTGCAAGG + Intronic
957485496 3:80857146-80857168 AATAGCAAGCAAATAATGTATGG - Intergenic
957688986 3:83543180-83543202 ACTAATAAGAAAATTCAATAAGG - Intergenic
957836262 3:85594695-85594717 ACTAATAAGTAAAAACAGAATGG - Intronic
958036751 3:88178872-88178894 ACTAATAAGCATCTACTAAAGGG + Intergenic
959191269 3:103113966-103113988 ACTAACAAGCCCAGACTGTAAGG + Intergenic
959538097 3:107509729-107509751 ACAAACAAACAAATACAGTAGGG - Intergenic
960192159 3:114719537-114719559 CCTAATAACCCAATACTGGAGGG - Intronic
960360862 3:116709496-116709518 AAAAATAAACAAAAACTGTATGG + Intronic
960893265 3:122473984-122474006 ACTAATAAGCAATTATAGCAAGG + Intronic
961025745 3:123555376-123555398 ACTAATAAGCAAGTATAGCAAGG + Intronic
963330304 3:143906963-143906985 ACTAATAAGCAATTATAGCAAGG - Intergenic
963656062 3:148052051-148052073 ACTAATAAGCAATTATTGTAAGG + Intergenic
963718578 3:148833425-148833447 ACTGACAAGGTAATACTGTAAGG - Intronic
963731575 3:148979310-148979332 ACTAATAAGCAATTATAGCAAGG - Intergenic
966107161 3:176350192-176350214 ACAAAAAAGCACATACTGCATGG + Intergenic
966118000 3:176488062-176488084 AATAATAAGAAACTACTGTGGGG + Intergenic
966133319 3:176669404-176669426 ACTGATAAACAAATTCAGTAAGG + Intergenic
967313048 3:188124516-188124538 ATTAATTAGCACATACTTTAGGG - Intergenic
967473769 3:189892050-189892072 AGTTATAAGCAAAAACTGCAGGG + Intronic
971886325 4:32453778-32453800 TCTAAGAAGCAGATTCTGTAAGG - Intergenic
972728196 4:41764984-41765006 ACACATAAGCAAAAACTCTAAGG - Intergenic
973317000 4:48771796-48771818 ACCATTCAGCAAGTACTGTATGG + Intronic
974527633 4:63063635-63063657 ATAGAAAAGCAAATACTGTATGG - Intergenic
974854893 4:67449060-67449082 ACTAATAAGCAATTACAGCAAGG + Intergenic
976680613 4:87752455-87752477 ACAAATAAACTAATACAGTATGG - Intergenic
976701372 4:87972349-87972371 ATTCATAAGCAAAAACTATAAGG + Intergenic
977065534 4:92309032-92309054 ACTAATAAGCCATTACACTAAGG + Intronic
977377972 4:96232515-96232537 ACTAATAAGCAAATATAGGAAGG + Intergenic
977509544 4:97945301-97945323 ATGAAAAACCAAATACTGTATGG - Intronic
977659647 4:99568289-99568311 ACTAATAAGCAATTATAGTAAGG + Intronic
977729703 4:100336354-100336376 ACTGATAAGCAACTTCAGTAAGG + Intergenic
978346008 4:107770187-107770209 ACTAATAAACAATTATAGTAAGG + Intergenic
978481881 4:109201764-109201786 ACTAATAAGCAATTATGGCAAGG + Intronic
978980447 4:114938670-114938692 TCTAATAAGCAAGTAGTGAATGG + Intronic
979004672 4:115277447-115277469 ACTCATAACCAAACATTGTAGGG + Intergenic
979394769 4:120174113-120174135 CCTAAAAAGCAAATACTTTGTGG + Intergenic
980617051 4:135242613-135242635 TTTAATAAGATAATACTGTAAGG - Intergenic
980839931 4:138246207-138246229 ATTAAAAAGCATATACTGCATGG + Intergenic
980864131 4:138534419-138534441 ACTAATAAGCAAATTCAGTGAGG + Intergenic
981186354 4:141808353-141808375 ACTCTTATGGAAATACTGTATGG + Intergenic
981265496 4:142778246-142778268 AATAAAAAGCAAAGACTGAAAGG - Intronic
981512602 4:145574131-145574153 ACTATTAAGCACTTACTGTGTGG - Intergenic
982799187 4:159681838-159681860 ACTAATAAGTAATTACAGCAAGG + Intergenic
983960215 4:173743456-173743478 ACTAATAAGAAGGTACAGTAAGG - Intergenic
984230256 4:177089164-177089186 CCTATTAATCAAATACTGCATGG - Intergenic
984855499 4:184191800-184191822 ACTAATAAACAAATTCAGTAAGG + Intronic
986138157 5:5002564-5002586 ACTAATAAACAAATTCAGTAAGG + Intergenic
986991696 5:13561045-13561067 ACTAATAAGTAAATATAGCAAGG + Intergenic
987273065 5:16332921-16332943 ACTAATAAGCAATTACTGTGAGG + Intergenic
987442810 5:17977846-17977868 ACTAATGAGCACTTACTGTGTGG + Intergenic
987569146 5:19632972-19632994 ACTAATTAGAAAATACAGTGTGG + Intronic
988098703 5:26651276-26651298 AGTAAGAAGCAAATACCATAAGG + Intergenic
988635084 5:32974662-32974684 ACTAATAAGCAATTATAGTAAGG - Intergenic
988852165 5:35190880-35190902 GGTAATGAGCAAATACTATAAGG + Intronic
989631625 5:43489222-43489244 ATTAATAAGCTAATAATGGAGGG + Intronic
989789819 5:45384179-45384201 ACTAAACACCAAATACTGCACGG - Intronic
990105984 5:52262210-52262232 ACAAAAGAACAAATACTGTATGG + Intergenic
990932530 5:61109311-61109333 ACTGATAAACAAATTCAGTAAGG - Intronic
991119160 5:62991368-62991390 ACTAATAAGCAATTACAGCCAGG - Intergenic
991619214 5:68528020-68528042 ACTAATAAGCAATTAGAGCAAGG - Intergenic
992355468 5:75977892-75977914 ATTAACATGCAAACACTGTATGG + Intergenic
995112929 5:108447329-108447351 ACTAATAAGCAATTATAGCAGGG + Intergenic
995637934 5:114216891-114216913 ACTAATAAGCAATTATAGCAAGG + Intergenic
995656288 5:114430469-114430491 ACTAATAAGTAAGTATTGCAAGG - Intronic
995735024 5:115290841-115290863 ACTAATAAACAAGTACAGCAAGG - Intronic
996641437 5:125759889-125759911 TCTAATAACCAAAATCTGTAAGG - Intergenic
997143007 5:131402937-131402959 ACTAATAAACAAATTCAGCAAGG + Intergenic
997768429 5:136528287-136528309 ACTACTAATCAAATAATGAAAGG - Intergenic
997821147 5:137067280-137067302 ATTAATAAAGAAATACTTTAGGG + Intronic
997857564 5:137386010-137386032 GCTAATAAGCAATTACAGCAAGG + Intronic
998329078 5:141307539-141307561 ACTAAAAAGCAAATTGTGCATGG + Intergenic
1000923391 5:167164814-167164836 ACTAATAAGCAAAGTATGGATGG - Intergenic
1001223095 5:169919788-169919810 ATTAATATGCAAATACTCCAGGG - Intronic
1001790299 5:174450819-174450841 ACTAATAAACAAATTCAGTAAGG + Intergenic
1002892190 6:1344618-1344640 ACTAATAAACAATTACAGCAAGG + Intergenic
1004671147 6:17798099-17798121 ACTAAAAAGCAGATACTATATGG - Intronic
1005210979 6:23462635-23462657 ACTAATAAGCAAGTATAGCAAGG + Intergenic
1005246978 6:23898168-23898190 ACTAATAAGCAATTATAGTAAGG - Intergenic
1005363954 6:25059069-25059091 ACTAATAAGCAGTTACAGCAGGG + Intergenic
1006256171 6:32834383-32834405 ACAAAAAGACAAATACTGTATGG + Intronic
1007159694 6:39778960-39778982 ACTAGAAAGCCAAGACTGTAGGG + Intergenic
1008640738 6:53459917-53459939 ACTGATAAACAAATTCAGTAAGG + Intergenic
1008765921 6:54914935-54914957 ACAAATATGCTAAAACTGTAGGG - Intronic
1008948267 6:57123878-57123900 ACTAATAAGCAATTATAGCAAGG - Intronic
1009051926 6:58286145-58286167 TCTATCAAGCAAATACTGAAGGG - Intergenic
1009737492 6:67695970-67695992 ACAAATGAGCAAATACAGCAAGG + Intergenic
1010475777 6:76285966-76285988 ACAAATAAGCACAGACTGCAAGG - Intergenic
1011081471 6:83494571-83494593 ACAAATAAGCAATTACAGCAAGG - Intergenic
1011094672 6:83647048-83647070 ACTAATAAGCAATTATAGCAAGG - Intronic
1012003883 6:93688271-93688293 ACTGATAAACAAATTCAGTAAGG + Intergenic
1012094194 6:94937490-94937512 ATTAATAAGAAAATATTGTTAGG + Intergenic
1012763792 6:103337530-103337552 ACAAATAAGCAAATATTTTAGGG - Intergenic
1012823608 6:104121129-104121151 ACTATTAAACAAATACTTTGGGG - Intergenic
1012891749 6:104904871-104904893 ACTAATAAGCAATTATAGCAAGG - Intergenic
1013021736 6:106228100-106228122 TCTAATAACCAAATAGTTTATGG - Intronic
1013440632 6:110163018-110163040 ACTAGTAAGCAATTACAGCATGG + Intronic
1013590612 6:111616763-111616785 ACTTATCAGTCAATACTGTAGGG + Intergenic
1014420906 6:121244707-121244729 ACAAATAAGTAAATATGGTATGG + Intronic
1015103642 6:129510524-129510546 ACTAATAAGCACATAATATGTGG + Intronic
1018526726 6:164718991-164719013 ACTAATAAGCAATTATGGCAAGG + Intergenic
1019600203 7:1878908-1878930 ACTAATAAGTAAATTCAGCAAGG + Intronic
1020155915 7:5724416-5724438 AGTCAGAAACAAATACTGTATGG + Intronic
1020393038 7:7680903-7680925 ACTAATAAATAAATTCAGTAAGG - Intronic
1020587917 7:10094354-10094376 ACTAATAAGCAATTACTACAAGG - Intergenic
1020834254 7:13128513-13128535 ATTGATAAGCAAATAGTGAAAGG + Intergenic
1021003994 7:15370768-15370790 ACTAATATGCAAAATCTATAAGG - Intronic
1021052030 7:15997637-15997659 ACCAATAAGAATATACTTTAGGG + Intergenic
1021290733 7:18841279-18841301 ACAATTAAGTAAATACTGTTTGG + Intronic
1023096479 7:36665399-36665421 ACTAATAAGCAATTATAGCAAGG - Intronic
1023597050 7:41841190-41841212 ACTAATAAGCAATTATAGCAAGG - Intergenic
1024019783 7:45357260-45357282 ACTAATAAGCAGTTATAGTAAGG + Intergenic
1024020993 7:45369476-45369498 ACTAATAAATGAATACAGTAAGG - Intergenic
1024062083 7:45705835-45705857 ACTAAGAAGCAATTATAGTAAGG + Intronic
1026345417 7:69469683-69469705 ACTAATAAGCAAATAGAGGGTGG + Intergenic
1026560728 7:71445924-71445946 ACTTTTAAGAAAATACTATAAGG - Intronic
1027786631 7:82587835-82587857 ACTAATGAACAAATTCAGTATGG - Intergenic
1030795768 7:113785383-113785405 AATAATAATAAAATATTGTATGG - Intergenic
1030834919 7:114271139-114271161 ACTAATAAGTAATTACAGCAAGG - Intronic
1032827636 7:135587827-135587849 AAGAGTAAGCAAAGACTGTAGGG - Intronic
1033204007 7:139400719-139400741 ACTAATCAGCAAATAGTGTTGGG - Intronic
1033828933 7:145228306-145228328 TCTACTACGCAAATATTGTATGG + Intergenic
1034023128 7:147667606-147667628 AACAATAAGCAAATCCTGAAAGG - Intronic
1035440693 7:158895983-158896005 AATAATAAGCAATTACAGCAAGG - Intronic
1035450697 7:158975116-158975138 ACTAATAAGCAATTATAGCAAGG + Intergenic
1035992979 8:4512564-4512586 ACTAATAAGCAATTATAGCAGGG + Intronic
1036538281 8:9674167-9674189 ACTAAGAATCAAATACAGGATGG + Intronic
1036544305 8:9751524-9751546 ACTGATAACCAAATACTTTGTGG - Intronic
1036580398 8:10069134-10069156 ACTAATAAGAAATTACAGCAAGG - Intronic
1037016939 8:13919691-13919713 ACTAATAAGCAATTATAGAAAGG - Intergenic
1037220522 8:16514116-16514138 ACTAATAAGGAAATGCCATAAGG - Intronic
1037567897 8:20132957-20132979 AATAATAAGCACTTACTGTGTGG - Intergenic
1037716888 8:21408399-21408421 ACAAATAAGCAACTGCTGAATGG + Intergenic
1038706771 8:29901616-29901638 ACTATAAAACAAATACTGTAGGG + Intergenic
1039140906 8:34386767-34386789 ACTAGTAAGCAACTATAGTAAGG + Intergenic
1039196468 8:35037009-35037031 ACTAATAAGTAAGTAAAGTAAGG + Intergenic
1039624446 8:39033280-39033302 ACTAAAAAGCAATTACAGTAAGG - Intronic
1039664110 8:39503312-39503334 ACAAATAAGCAAATAATTGATGG + Intergenic
1039933725 8:42020232-42020254 AGTAATCAGCAGAGACTGTATGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040632196 8:49228184-49228206 ACTAATAAACAAATTCTGCAAGG + Intergenic
1041305679 8:56455960-56455982 ACTAATAAGCAATTATAGCAGGG + Intergenic
1043144555 8:76636689-76636711 ACTAATAAGCAATTATAGGAAGG + Intergenic
1044415277 8:91931947-91931969 ACTCATAAGCAAATCCATTAGGG + Intergenic
1045623728 8:104016030-104016052 ACTCAGAAGAAAATACTGAATGG + Intronic
1046502002 8:115089809-115089831 ACTAATAAGCAAATATAGCAAGG - Intergenic
1046518504 8:115293912-115293934 ACTAGTAAGCAAAAAATGAAAGG + Intergenic
1046995301 8:120513356-120513378 AACAATAAGCAAATGCTTTATGG - Intronic
1048514083 8:135089614-135089636 AATAATAAGCATATATAGTAGGG - Intergenic
1049140097 8:140946486-140946508 ACTAGTAAACAAATACTATTAGG + Intronic
1050881369 9:10704257-10704279 ACTAATAATAAAATACTGAATGG - Intergenic
1051116432 9:13699367-13699389 ACTAATAAGCAATTATGGAAAGG - Intergenic
1051432152 9:16990517-16990539 ACAAAAAGACAAATACTGTATGG + Intergenic
1055746529 9:79452279-79452301 ACTAATAAACAAATATAGCAAGG - Intergenic
1056871818 9:90288873-90288895 ACTAATAAGCAAATTTGTTAGGG - Intergenic
1058001250 9:99868266-99868288 ACAAAAATACAAATACTGTATGG - Intergenic
1059006740 9:110410801-110410823 ACTAATTAGCAAATGCTCTGTGG - Intronic
1059729085 9:117039034-117039056 TCTAATTAGCAAATACTCTTTGG + Intronic
1185500732 X:595288-595310 CCTAATGATTAAATACTGTAGGG + Intergenic
1186413744 X:9365473-9365495 AAAAAAAAACAAATACTGTAAGG - Intergenic
1186612383 X:11150535-11150557 AATAATAAGGAAATTCTGTTTGG - Intronic
1187142484 X:16607132-16607154 ACTAATATACAAATCCTGTCTGG - Intronic
1187736488 X:22310059-22310081 ACTAATAAGCAATTAAAGCAAGG - Intergenic
1189447226 X:41092068-41092090 ATTAATAAGAATAAACTGTAGGG - Intronic
1189535666 X:41933030-41933052 ACAAAAAGGCAAACACTGTATGG + Intergenic
1190551763 X:51589586-51589608 ACTAATAAGCAATTATAGCAAGG + Intergenic
1190749587 X:53349915-53349937 ACTAATAAGCAATTATAGCAAGG + Intergenic
1191967206 X:66772248-66772270 ACTGAGAAACAAATACAGTAAGG - Intergenic
1192732182 X:73811636-73811658 AATTAAAAGCAAATACTCTAGGG - Intergenic
1192862516 X:75091708-75091730 ACTAAAAAGCAATTACAGCAAGG + Intronic
1193223759 X:78957470-78957492 ACTAACAAGAAAATCCTGGATGG - Intronic
1193344863 X:80393797-80393819 ACAAAAAAACAAATACTGCATGG - Intronic
1193991142 X:88308839-88308861 TCTAATATTCAAAAACTGTAAGG - Intergenic
1194171539 X:90590303-90590325 ACTAATAAGCAATTAAAATAAGG - Intergenic
1194542933 X:95196946-95196968 ACTAATAAGCAATTATAGCAAGG - Intergenic
1194815741 X:98439572-98439594 ATTAATAAGTAAATGGTGTATGG - Intergenic
1195815915 X:108887350-108887372 ACTAATAATCAAATACAATGAGG + Intergenic
1196167701 X:112553589-112553611 ACTATGATGCAAATACTATAAGG + Intergenic
1196313212 X:114193332-114193354 ACTAATAAGCAATTATAGCAAGG + Intergenic
1196523413 X:116701740-116701762 ACTAATAAGAAACTACAGTAGGG - Intergenic
1196672394 X:118382686-118382708 TCTTATAACCAAATACTGCAGGG + Intronic
1196700958 X:118667989-118668011 ACTAATAAGCAGATTTAGTAAGG - Intronic
1197539430 X:127738295-127738317 ACTAAAAAGCAAATATAGAAAGG + Intergenic
1198384033 X:136110912-136110934 ACTAATAAGCAAATTAAGCAAGG - Intergenic
1199261205 X:145777885-145777907 TCTAATAAGCAGAAACTTTAGGG + Intergenic
1200277605 X:154749584-154749606 ACTCAAAAGCAAATGATGTAGGG + Intronic
1200328475 X:155267828-155267850 ACTAATAAGCAAGTTCAGCAAGG - Intergenic
1200517771 Y:4168052-4168074 ACTAATAAGCAATTAAAATAAGG - Intergenic
1202297070 Y:23370375-23370397 ACTAATCAGCAAATACCTCAAGG - Intergenic
1202573737 Y:26300222-26300244 ACTAATCAGCAAATACCTCAAGG + Intergenic