ID: 1141039046

View in Genome Browser
Species Human (GRCh38)
Location 16:80655784-80655806
Sequence CCTTCTCTCCAGGAGACGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141039046 Original CRISPR CCTTCTCTCCAGGAGACGCA GGG Intronic
900565463 1:3329758-3329780 CCCTCTCTCCAGAAGCCGCACGG - Intronic
900730502 1:4255804-4255826 CCTTCACTCCAGGACCCCCAGGG + Intergenic
903273195 1:22204916-22204938 CCTTCTCCCCCGAAGACCCAGGG + Intergenic
903471314 1:23589348-23589370 CCATCTCTCCAGGATTAGCAAGG + Intronic
904041886 1:27590109-27590131 CCTCCCCTCCAGGAGAAGGAGGG - Intronic
904906243 1:33899337-33899359 CCATCTCTCCAGGATACCCAAGG + Intronic
906023590 1:42653972-42653994 GCTTCTCTGAAGGAGACACATGG + Exonic
910333864 1:86105840-86105862 CCTGTTCTCCAGGAGTCGCTGGG + Intronic
910334150 1:86109027-86109049 CCTCCTCTCCACAAGACCCAGGG - Intronic
911427540 1:97738468-97738490 CCTTTTCTCAAAGAGGCGCAAGG + Intronic
912692140 1:111812445-111812467 GCTTCCCTCCAGGGGAAGCAGGG + Intronic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
915342129 1:155182298-155182320 GCCTGTGTCCAGGAGACGCATGG + Intronic
920180552 1:204129602-204129624 CGGTCTCTGCCGGAGACGCACGG - Intergenic
921619494 1:217310368-217310390 TCTTCTCTCCTGCAGACGCAGGG + Intergenic
922785165 1:228279024-228279046 CCTACACTCCTGGAGACGCTGGG + Intronic
1063364050 10:5479085-5479107 CCTTCTCTCCTGGAGGCCCCTGG + Intergenic
1064369819 10:14741504-14741526 CCATCCCTCCTGGAGATGCAGGG - Intronic
1064885724 10:20110277-20110299 TCTTCTCTCCAGGATAGGCAAGG - Intronic
1066041704 10:31554637-31554659 ACTTCTCTACTGGAAACGCAAGG - Intergenic
1067539119 10:47138839-47138861 ACTTCTCTCCTGGAGACAGAGGG + Intergenic
1075702638 10:124479127-124479149 CCTCCTCCCCAGGAGTCCCATGG - Intronic
1076382795 10:130036772-130036794 CTTTCTCTCCAGAGGACGCTGGG + Intergenic
1076542043 10:131220649-131220671 CCTTCTCTACAGCTGAGGCAGGG - Intronic
1077479172 11:2805174-2805196 CTTTGTCTCTAGAAGACGCAGGG + Intronic
1077922232 11:6650303-6650325 CCCTTTCACCAGGAGACACAGGG + Intronic
1079939577 11:26662135-26662157 CTTTCTCTCCAGAAGAAACATGG + Exonic
1081639189 11:44741100-44741122 GCTTTTCTCCAGGGGACACAAGG - Intronic
1081967362 11:47177862-47177884 CCGGCTCTCCAGGAGAAGCTGGG + Exonic
1082717132 11:56627901-56627923 ACTTCTCGCCAGGACACACAAGG - Intergenic
1083126393 11:60571259-60571281 CATTCCCACCAGCAGACGCAAGG - Intergenic
1084085848 11:66854860-66854882 GCATCTCTTCAGGAGAGGCAGGG - Intronic
1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG + Intergenic
1085705277 11:78781655-78781677 CTTACTCTCCAGGAGCCTCAGGG + Intronic
1088985827 11:114907169-114907191 GCATCTTTCCAGGAGACCCAAGG - Intergenic
1089160764 11:116435335-116435357 CCTTCTCTCCAGAGCACCCAGGG - Intergenic
1090406498 11:126478934-126478956 CCCTCTCTCGAGGAGAGACAGGG - Intronic
1090480153 11:127060952-127060974 CCATCTCTCCAGTCCACGCAGGG + Intergenic
1091613122 12:2028533-2028555 CCTTTTATCCAGGACAAGCATGG + Intronic
1091912376 12:4242851-4242873 TCTGCACTCCAGGAGCCGCAAGG + Intergenic
1093129053 12:15367877-15367899 CCTTCACTCCAGGTGAGGCTTGG - Intronic
1094375292 12:29783301-29783323 CCTCCTCTCCAGGATGTGCATGG - Intronic
1095906759 12:47386035-47386057 CCCACTCACCAGGAGAAGCAGGG + Intergenic
1096018188 12:48297283-48297305 CCTGCTCTCAAGGAGAAGTAAGG + Intergenic
1097637845 12:62144114-62144136 CCTTCTCTGCAGGAAACAAATGG + Intronic
1097767204 12:63539623-63539645 GGTTCTCTCCAGGAGAGCCAAGG + Intergenic
1097783548 12:63734566-63734588 GGTTCTCTCCAGGAGAGCCAAGG + Intergenic
1098544584 12:71697439-71697461 CCTGCTCTGCTGGAGACACATGG + Exonic
1100209152 12:92383329-92383351 CCTTCTCTCAAGGAGACTAGTGG + Intergenic
1100308896 12:93376861-93376883 CCTACGCTCCTGGAGAGGCAGGG + Intergenic
1101046621 12:100813207-100813229 CCTTATTTCCAGGGGAAGCATGG + Intronic
1103934050 12:124466035-124466057 CCCTCTCCCCCAGAGACGCAGGG - Intronic
1104613270 12:130247624-130247646 CCTGCCCTCCAAGAGACTCACGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1110928766 13:81188519-81188541 CCATTTCTCCAGGAGTGGCAAGG - Intergenic
1111450612 13:88410075-88410097 CGTGCTCTCCAGGAGACTAAGGG - Intergenic
1113457482 13:110458759-110458781 CCTCCTCTGCAGGTGACGCTGGG + Exonic
1114757037 14:25270896-25270918 TCTTCCCTCCAGAAGATGCAGGG - Intergenic
1116752521 14:48904400-48904422 CCTTCCCTCCAGAGGACTCAGGG + Intergenic
1119747430 14:77054134-77054156 CTTTCTCTCCAGGTGACACATGG + Intergenic
1120732923 14:88023077-88023099 CCTACTCTCCAGGGCAGGCATGG - Intergenic
1121442098 14:93955846-93955868 CCTTCTCTGCAGGACACGGCTGG - Intronic
1122829657 14:104389605-104389627 CCTTCTCTCCAGGAAGGCCAGGG - Intergenic
1124596870 15:31098674-31098696 CCCTGTCTCCAGGAGAGCCAGGG + Intronic
1125289572 15:38130843-38130865 CTTCCTCTCTAGGAGAGGCAAGG + Intergenic
1125703288 15:41707846-41707868 CATACTCACCAGGAGAGGCAGGG - Exonic
1126111765 15:45179404-45179426 CCTGCCCTCCAGGAGCCACAGGG - Intronic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1129230595 15:74195119-74195141 GCTGCTCTGCAGGAGAGGCAGGG - Intronic
1130759909 15:86808268-86808290 TCTTCTCTACAGGAAAGGCACGG - Intronic
1132621074 16:868561-868583 CCCTCACTCCAGGAGCCCCAGGG - Intronic
1133779757 16:8928863-8928885 CATTCTCCCCAGGAGACACCTGG + Intronic
1134215153 16:12311499-12311521 CATTTCCTCCAGGAGATGCAGGG + Intronic
1135184077 16:20299707-20299729 TCTTCTCTCCAGCAGATGAAGGG + Intergenic
1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG + Intergenic
1137869347 16:51934456-51934478 CATTCCCCCCAGGAGAGGCACGG - Intergenic
1138122257 16:54410125-54410147 CCATCCCTCCAGGAGGCGCGGGG + Intergenic
1139340503 16:66265022-66265044 CCTTCTCCCCTGGAGTCCCATGG - Intergenic
1141039046 16:80655784-80655806 CCTTCTCTCCAGGAGACGCAGGG + Intronic
1142347156 16:89561212-89561234 GCTTCTCTCCACCAGACGTAAGG + Exonic
1142603909 17:1071335-1071357 CTTTCTCCCCAGGAGACCCTGGG + Intronic
1142614724 17:1127598-1127620 CCTCCTCTCCAGGAGGCTCCAGG + Intronic
1143890400 17:10098158-10098180 TCTTCTCTCCAGGAGACTCTTGG + Intronic
1146124776 17:30222899-30222921 CCTTGCCTCCAGGAGACCTAGGG + Exonic
1146749362 17:35363944-35363966 CCTTCTCTTTAGGAGAAGAATGG + Intronic
1147449653 17:40496167-40496189 CCTTCTCACCAGGGGACGGCAGG + Exonic
1147935143 17:44006797-44006819 CCTCCTGTCCAGGAGCCGTAGGG + Intronic
1148062502 17:44846466-44846488 CCTCCTCTCCTGGAGGAGCAAGG - Intronic
1149956496 17:61056701-61056723 CATCCTGTCCAGGAGACCCAGGG + Intronic
1151470096 17:74312594-74312616 CCTTCCCTCCAGGGGTCTCAAGG - Intronic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1154169124 18:12038233-12038255 CAGTCTCTCCAGGAGCCCCAGGG - Intergenic
1155570224 18:27184912-27184934 CCTTCACTTCAGTGGACGCATGG - Intronic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1157675642 18:49566724-49566746 GCTTCTCTCTTAGAGACGCAGGG - Intronic
1158657257 18:59349494-59349516 CCTTCTCTCAAGAAGACCTAGGG + Intronic
1160451942 18:78972437-78972459 CCTTCGCTGATGGAGACGCATGG - Intergenic
1161099635 19:2415326-2415348 GCTGCACTCCAGGAGACCCATGG - Intronic
1161588118 19:5116597-5116619 CCTTCTCTCCATGACACCCCTGG - Intronic
1161767569 19:6215910-6215932 CCTTTTCCCCAGGAGGCACAGGG - Intronic
1163433875 19:17283645-17283667 ACTCCTGTCCAGGAGAGGCATGG - Exonic
1166814402 19:45533828-45533850 CCTTCTTTCGGGGAGAAGCATGG - Intronic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
925134856 2:1519375-1519397 TCTTCTCGCGAGGAGAAGCAGGG - Intronic
926082880 2:10003054-10003076 CCTGCTCTCCAGGAAACGAGAGG - Intergenic
926975814 2:18515808-18515830 CCACCTCTGCAGGAGACTCATGG - Intergenic
927972723 2:27315937-27315959 CCTTCTCTCAAGGAGGACCAAGG + Intronic
929683449 2:44013979-44014001 CATTCTCTCCTGGAGATCCAAGG - Intergenic
931607403 2:64066051-64066073 CCCTCTCTCCATTAGAGGCAGGG - Intergenic
931665770 2:64608989-64609011 CCTTGTCCACAGGAGACACAAGG - Intergenic
932368560 2:71169066-71169088 CATTCTCTCCAGGATCAGCAAGG - Intergenic
932494973 2:72141693-72141715 CATTCTCTCCAGGACAATCATGG + Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
936628066 2:114170030-114170052 CAATCTCACCAGGAGACCCAAGG - Intergenic
936638279 2:114284111-114284133 CCTTCTCGCCAGGAGTCACCAGG - Intergenic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
940559867 2:155281559-155281581 CCTTTTCTCAAGCAGATGCAAGG + Intergenic
940659677 2:156531409-156531431 ACTTCTCTCCAGAAGATGCAAGG + Intronic
941844853 2:170122361-170122383 CCTGCCCTCCAGGAGACGTCGGG - Intergenic
944614202 2:201443355-201443377 CTCTCTCTCCAGGAGAGCCAAGG - Intronic
946171537 2:217898736-217898758 CCACCTCTCCGGGAAACGCATGG - Intronic
947167034 2:227273060-227273082 CCTGGTCTCCAGGGCACGCAAGG + Exonic
947463614 2:230323384-230323406 CCCCCTCTCCTGGCGACGCAGGG - Intergenic
1169933318 20:10857175-10857197 CCTTCTCTTCAGGAGATTGAAGG - Intergenic
1171334526 20:24371322-24371344 GCTTATCTCCAGGAGTCTCAGGG - Intergenic
1173800401 20:45891340-45891362 CTTGCTCTCCAGGAGGCGCCCGG - Exonic
1175723356 20:61300717-61300739 CCCTTTCTCCAGGACACTCATGG + Intronic
1175791125 20:61740545-61740567 CCTGCTTTCCAGGAGAAGAAAGG - Intronic
1176188644 20:63795789-63795811 CCTTCACTCCAGCTGACCCAGGG - Intronic
1178367038 21:31996828-31996850 GCTTCTCTCCGGGAGCAGCATGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1180902172 22:19382268-19382290 CCTTCTCACCAGGTAACGCCTGG + Intronic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181756573 22:25028700-25028722 CCTTCTCTTCAGGCGAGGCCTGG - Exonic
1183464419 22:37972585-37972607 CCTTGGCTCCAGGAGACACAGGG - Exonic
1184716036 22:46282320-46282342 CCCTCTTTCCAGGGGAGGCAAGG + Intronic
1185333270 22:50261021-50261043 CCTTCTCCCCTGGGGACCCACGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
959818963 3:110709629-110709651 CCTTATCTCAAGGTGAGGCAGGG - Intergenic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
963758389 3:149259494-149259516 CCTCCTCCCCAGGAGTCTCAGGG + Intergenic
966721215 3:183064431-183064453 CCCTCGCTCCAGGAGACGCTTGG + Intronic
967742639 3:193020228-193020250 CCTTCTCTCCATGAGAAGCTGGG - Intergenic
968610257 4:1553845-1553867 CATTCTCTCCAGGAGCCCCGTGG - Intergenic
970814445 4:20137560-20137582 CCTTATCTCCAGTAGCCACAGGG + Intergenic
971325906 4:25643541-25643563 TCCTCTCTCCAAGAGAAGCAGGG - Intergenic
986343289 5:6811165-6811187 CCTCCTCTCCAGCAAAGGCAGGG + Intergenic
986783293 5:11086299-11086321 CCTCTTCTCCAGGACACACATGG - Intronic
986928810 5:12794145-12794167 CCTACTCTCCTGGAGGGGCAGGG + Intergenic
989193847 5:38696505-38696527 CCTTCTCTCAAGGACAAGCATGG + Intergenic
992612012 5:78516032-78516054 CCTTCTCTTCAGAAGACAAAAGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995829089 5:116334151-116334173 CCTTGGCTCCAGGACAAGCATGG - Intronic
997266758 5:132499318-132499340 CCTACTTTCCAGGAGAGGAATGG - Intergenic
997689946 5:135821620-135821642 ACATCTCCCCAGGAGACTCAGGG - Intergenic
998509252 5:142697782-142697804 CCTTCGCTCCAGGGGAATCAGGG - Exonic
999135729 5:149317639-149317661 CCTTCTTTCCAGCAGACACATGG + Intronic
1000542369 5:162555892-162555914 AATTGTCTCCAGGAGACGAATGG - Intergenic
1001547662 5:172580422-172580444 CCTGCTCTCCAGGAGCAGCTGGG - Intergenic
1003125267 6:3351032-3351054 CATTTCCTCCAGGAGAAGCAAGG + Intronic
1006296878 6:33173700-33173722 CCCTCTCTCCAGGGGGCCCATGG + Exonic
1007836531 6:44678293-44678315 CCTTCACTCCAGGAGAATGAAGG - Intergenic
1007930351 6:45685379-45685401 CAGTCTCTCCAGGAGAATCAGGG + Intergenic
1010354617 6:74917264-74917286 TCTTTTCTCCAGAAGAAGCAGGG - Intergenic
1010716122 6:79232616-79232638 GCCTCTCTCAAGGAGACGGAAGG - Intronic
1011759966 6:90553058-90553080 CCTTTTCTCCTGAAGAAGCAAGG - Intronic
1014969873 6:127801345-127801367 CTTTCTGTACAGGAGACTCAGGG - Intronic
1017717740 6:157224125-157224147 TCTTCTCTCCCAGAGACACATGG - Intergenic
1018349407 6:162941224-162941246 TCTTCTCTCCAGTAGTCCCAAGG + Intronic
1019155263 6:170034278-170034300 CCTTCTCTCCAGGAGCCCTCGGG - Intergenic
1019175747 6:170158567-170158589 CCTTCTCTCCTGGAGCCTCCAGG + Intergenic
1020006481 7:4786141-4786163 CCTGCTCTCCAGGACACCAAGGG - Intronic
1023573826 7:41603271-41603293 CCTTCTCTCCAGAAATTGCATGG + Intergenic
1024576334 7:50767630-50767652 CCTGCTGGCCAGGAGCCGCAGGG - Intronic
1028922263 7:96321789-96321811 CCCTCCCTCCAGCAGCCGCAAGG + Intronic
1029115769 7:98236369-98236391 CCTTCTGTCCAGGGGAAACAAGG - Intronic
1029597449 7:101545360-101545382 CCATCTCTCCAGGAAGCCCACGG - Exonic
1030084977 7:105808135-105808157 CCTTCTCCCCAGGACACACAGGG + Intronic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1037434134 8:18845315-18845337 CATCCACTCCAGGAGACGCAGGG - Intronic
1042221503 8:66478740-66478762 CCTTCTCTCCAGGGAAGTCAAGG + Intronic
1043150080 8:76704595-76704617 TCTTCTCTCCAGCAGATGCCAGG - Exonic
1047019502 8:120759798-120759820 CCTTCTCTCAAGGAGACTCTAGG - Intronic
1048550270 8:135427405-135427427 CTTTCTCTCCAGGAGAAGGCAGG - Intergenic
1049014540 8:139910239-139910261 CCTTCTCCCCAGGGGACTCCGGG + Exonic
1051775884 9:20633710-20633732 CTTTTTCCCCAGGAGAAGCAGGG - Intergenic
1051950145 9:22621366-22621388 CCAGCTCTCCAGGAGACCCTAGG - Intergenic
1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG + Intergenic
1057911746 9:99024951-99024973 CATCCTCTCCAGGAGATCCAGGG - Exonic
1058103125 9:100938321-100938343 CCTCCTCTCCAGGAAAGGCTCGG - Intergenic
1061078863 9:128357990-128358012 ACTTCTGTCCAGGAAAGGCAGGG + Intronic
1061573944 9:131494689-131494711 CCTTCTCTGCAGGACAAGGAAGG - Intronic
1062514622 9:136926381-136926403 CCTTCTCTCCAGGGGCCAGAGGG - Exonic
1203744607 Un_GL000218v1:34964-34986 CTTTCTGTCCAGGAGACACCTGG - Intergenic
1203565497 Un_KI270744v1:84520-84542 CTTTCTGTCCAGGAGACACCTGG + Intergenic
1185591874 X:1282702-1282724 GCTTGTCACCAGGAGAAGCATGG - Exonic
1186664439 X:11703644-11703666 CTATCTCCCCAGGAGACGAATGG - Intergenic
1190411360 X:50140211-50140233 CCTTTTCTCCAGGGTACGAAGGG - Intergenic
1200160041 X:154002390-154002412 CCTTCTCTCCCAGAAAAGCATGG + Intergenic
1200324839 X:155225506-155225528 CTTTCTCTTCAGGTGAAGCAGGG + Intronic
1200838346 Y:7754631-7754653 CCTTCTGTCCAGGAGAAGTTTGG - Intergenic