ID: 1141039938

View in Genome Browser
Species Human (GRCh38)
Location 16:80664407-80664429
Sequence GGCCCAGGACACCGGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 357}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141039938_1141039945 18 Left 1141039938 16:80664407-80664429 CCAGGGCTCCGGTGTCCTGGGCC 0: 1
1: 0
2: 2
3: 33
4: 357
Right 1141039945 16:80664448-80664470 CAGCTTTGCAGCAGGTCACTGGG 0: 1
1: 0
2: 0
3: 18
4: 181
1141039938_1141039946 19 Left 1141039938 16:80664407-80664429 CCAGGGCTCCGGTGTCCTGGGCC 0: 1
1: 0
2: 2
3: 33
4: 357
Right 1141039946 16:80664449-80664471 AGCTTTGCAGCAGGTCACTGGGG 0: 1
1: 1
2: 1
3: 19
4: 244
1141039938_1141039943 10 Left 1141039938 16:80664407-80664429 CCAGGGCTCCGGTGTCCTGGGCC 0: 1
1: 0
2: 2
3: 33
4: 357
Right 1141039943 16:80664440-80664462 CGCATGCTCAGCTTTGCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 118
1141039938_1141039944 17 Left 1141039938 16:80664407-80664429 CCAGGGCTCCGGTGTCCTGGGCC 0: 1
1: 0
2: 2
3: 33
4: 357
Right 1141039944 16:80664447-80664469 TCAGCTTTGCAGCAGGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141039938 Original CRISPR GGCCCAGGACACCGGAGCCC TGG (reversed) Intronic