ID: 1141043719

View in Genome Browser
Species Human (GRCh38)
Location 16:80695110-80695132
Sequence AACAAACATCTGGCCAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141043719_1141043722 -1 Left 1141043719 16:80695110-80695132 CCAAATCTGGCCAGATGTTTGTT No data
Right 1141043722 16:80695132-80695154 TTTTGGAAGTAAAGTTTTATTGG 0: 1
1: 51
2: 912
3: 1476
4: 1979

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141043719 Original CRISPR AACAAACATCTGGCCAGATT TGG (reversed) Intronic
No off target data available for this crispr