ID: 1141044337

View in Genome Browser
Species Human (GRCh38)
Location 16:80703028-80703050
Sequence ATATATACACACATGAATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 780
Summary {0: 1, 1: 0, 2: 4, 3: 82, 4: 693}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141044337 Original CRISPR ATATATACACACATGAATCT AGG Intronic
902558869 1:17264243-17264265 ATACATACACACATGATCATTGG + Intronic
904105783 1:28081550-28081572 ATATATACATGTATGAATTTTGG - Intronic
904571876 1:31472426-31472448 ATAAAGACACACCTGAAACTGGG + Intergenic
904970370 1:34414723-34414745 ATATACACACACATGCATGAAGG + Intergenic
905072324 1:35237861-35237883 ATATATATATATATGAATGTCGG + Intergenic
905966487 1:42102615-42102637 ATATATGCACACATTTCTCTTGG - Intergenic
906317537 1:44797996-44798018 ATATATATATACACGAATTTTGG + Intergenic
906865762 1:49417970-49417992 AAACATGTACACATGAATCTAGG - Intronic
906956165 1:50376622-50376644 ATATATACACACGTATATATGGG - Intergenic
907079108 1:51604950-51604972 ATTTATAAAAACATGAAGCTAGG - Intronic
907695531 1:56723843-56723865 ATATGTACACACACGTATGTAGG + Intronic
907893520 1:58660485-58660507 ATACACACACACAAAAATCTAGG + Intronic
908097029 1:60749827-60749849 ATTTCTAAACAAATGAATCTGGG - Intergenic
908536302 1:65081155-65081177 TTATATACACACATATATGTGGG - Intergenic
908611993 1:65872140-65872162 ATATCTGCACACATAAATTTGGG - Intronic
909070666 1:70990056-70990078 ATATATATACACATACAGCTGGG + Intronic
909185216 1:72479060-72479082 ATAAAGACACACGTGAAACTGGG + Intergenic
909353203 1:74677681-74677703 AAATATCAACACATGAATTTTGG - Intergenic
909529499 1:76666370-76666392 ATATATACACATATATATATGGG - Intergenic
909709985 1:78637774-78637796 ATAAATACATACATACATCTTGG - Intronic
909876003 1:80804332-80804354 ATATATATACACATACATATAGG - Intergenic
909991241 1:82225038-82225060 AAATATATACACATGAGACTGGG - Intergenic
910017716 1:82547686-82547708 ATATTTAAAAACATGACTCTGGG - Intergenic
910054715 1:83019013-83019035 ATATATATACATATGTATATAGG - Intergenic
910073401 1:83246743-83246765 ATAGATACACACACAAATATAGG + Intergenic
910213009 1:84813189-84813211 ATATACACACACATGCATGGAGG + Exonic
910315484 1:85877656-85877678 TTAAAAACACACATGAAGCTGGG - Intronic
910725578 1:90334652-90334674 ACATATACACACATACAGCTGGG - Intergenic
910857572 1:91710943-91710965 AGATTAACACACATGAAGCTGGG + Intronic
911427125 1:97732032-97732054 ATTTATACTAACATGACTCTTGG + Intronic
911569045 1:99500294-99500316 ATATATACACACAATTAGCTGGG - Intergenic
911662625 1:100520015-100520037 ACATATACACACATAATTATGGG - Intronic
911854770 1:102862450-102862472 ATATATACACAATGGAATATAGG - Intergenic
911854774 1:102862490-102862512 ATATATACACAATGGAATCCTGG - Intergenic
912461916 1:109840084-109840106 ATATATAAACATATGTATCTAGG + Intergenic
912783093 1:112571759-112571781 ATAGTTACAAACATGAATTTTGG - Intronic
913351401 1:117864658-117864680 ATATATATAAACATAAAACTAGG - Exonic
913522497 1:119658744-119658766 ATATATACATGCATGTTTCTTGG + Intergenic
913597295 1:120390758-120390780 ATATACACACACATATATATGGG - Intergenic
914076325 1:144355381-144355403 ATAAAGACACATATGATTCTTGG + Intergenic
914090033 1:144488555-144488577 ATATACACACACATATATATGGG + Intergenic
914102853 1:144611116-144611138 ATAAAGACACATATGATTCTTGG - Intergenic
914308579 1:146445682-146445704 ATATACACACACATATATATGGG - Intergenic
914593530 1:149127448-149127470 ATATACACACACATATATATGGG + Intergenic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
916253356 1:162760884-162760906 ATAGATACACACACGAATCAGGG - Intronic
916799691 1:168204817-168204839 ATATATACACATAAAAAGCTTGG + Intergenic
917014073 1:170509871-170509893 ATATATACACGTATGTATCATGG + Intergenic
917624690 1:176833807-176833829 ATATATACACATATATATGTAGG - Intronic
917960350 1:180138990-180139012 ATATATACACATATATATGTGGG + Intergenic
918498931 1:185171926-185171948 ATATATGCATGCATGAATGTAGG - Intronic
918644733 1:186890528-186890550 ATAAATACCCACTTGAATCAGGG - Intronic
919032788 1:192266306-192266328 ATATATATATACATGAAAATAGG + Intergenic
919369974 1:196710669-196710691 ACACATTCACAGATGAATCTGGG + Intronic
920308890 1:205036621-205036643 ATTTAATCAAACATGAATCTAGG - Intergenic
920808925 1:209264085-209264107 ATATATAAACACACGTATATAGG + Intergenic
920924210 1:210326957-210326979 ATACACACACACATAAATTTTGG + Intergenic
921440295 1:215177707-215177729 ATATATACACATATATATATAGG - Intronic
921617786 1:217291838-217291860 ACATATACACACATGGCTATTGG - Intergenic
921663303 1:217834503-217834525 ATAAATACACACATTAGCCTAGG - Intronic
923478877 1:234364129-234364151 ATATATACATACATACATATAGG + Intergenic
923893074 1:238237156-238237178 ATATATACACAGTTGACCCTCGG - Intergenic
924406521 1:243753499-243753521 ATATACACACAAATGACCCTAGG + Intronic
924564951 1:245189774-245189796 ATAAAGACACACATGAGACTGGG + Intronic
924908385 1:248481785-248481807 GTTTATACACACAGGAATATTGG - Intergenic
924915725 1:248566300-248566322 GTTTATACACACAGGAATATTGG + Intergenic
1062790772 10:303868-303890 ACACAGACACACATTAATCTGGG + Intronic
1063257583 10:4345257-4345279 AAATATACACACACGTATCTGGG - Intergenic
1063728037 10:8661284-8661306 ATATATACACATATGTATTCGGG + Intergenic
1063856372 10:10258863-10258885 ATATATACACACATATATCTAGG + Intergenic
1064594001 10:16924508-16924530 ATATATATATATATGAATCTGGG + Intronic
1065964543 10:30760589-30760611 AGAAATACACACATGAGGCTGGG - Intergenic
1066010134 10:31187485-31187507 ATATATGCACACATTATCCTTGG - Intergenic
1066213752 10:33265940-33265962 ATATATACATACATGATATTGGG + Intronic
1066331067 10:34423689-34423711 ATACATACACAACTGAATTTGGG + Intronic
1066511076 10:36097053-36097075 ACAAATACACACATTAACCTAGG + Intergenic
1066596785 10:37059662-37059684 ATATATTTACACATGAAGATAGG + Intergenic
1066951961 10:42127619-42127641 ATAAAGACACATATGATTCTTGG - Intergenic
1067280844 10:44871432-44871454 CTATGTTCACACATTAATCTGGG + Intergenic
1068154486 10:53180010-53180032 ATATATACACATACAAATATTGG - Intergenic
1068557453 10:58474939-58474961 ATATATACACACACACATATAGG - Intergenic
1069211518 10:65767122-65767144 AGATATCAACACATGAATTTGGG - Intergenic
1069770861 10:70898947-70898969 AAATACACAAACATGAATTTGGG - Intergenic
1070882622 10:79862715-79862737 ATATATAGACACATGAACAGAGG - Intergenic
1071414808 10:85431406-85431428 ATATATATACACATATATCATGG - Intergenic
1071649189 10:87379017-87379039 ATATATAGACACATGAACAGAGG - Intergenic
1071781286 10:88848135-88848157 ATATATACACGCATATATGTTGG - Intronic
1075102742 10:119517706-119517728 ACACATACACACATGAATCCAGG + Intronic
1075363136 10:121858166-121858188 ATATATACACAAAAGAAAATAGG - Intronic
1076133036 10:128026884-128026906 GTATATTCACACTTGAAGCTTGG + Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076211615 10:128651007-128651029 ATATATACACACATACACCATGG - Intergenic
1076922315 10:133460463-133460485 ATATATATATATATGAATTTCGG - Intergenic
1076989480 11:263785-263807 ATATATACACACACACATATAGG + Intergenic
1078124996 11:8552626-8552648 ACATACACACACATTAGTCTAGG + Intronic
1078564188 11:12399655-12399677 ATACACACACACAAGAAACTTGG - Intronic
1078907165 11:15698283-15698305 ATATATGCACACATATATGTAGG - Intergenic
1079676064 11:23228262-23228284 ATATATACACATTTGAAACAGGG - Intergenic
1080391000 11:31846596-31846618 ACACATACACATATGAATGTAGG - Intronic
1081299304 11:41430779-41430801 ATATATATACACAAAAATATAGG - Intronic
1082674812 11:56083918-56083940 ACATACACACACATATATCTGGG + Intergenic
1082942407 11:58721581-58721603 ACACATACACACATACATCTTGG + Intronic
1082957598 11:58886780-58886802 GTCTATACCCACATGAAGCTGGG - Intronic
1084558401 11:69889061-69889083 CTCTAGACACACATGGATCTGGG - Intergenic
1084907531 11:72359702-72359724 ATACACACACACATGAAATTTGG - Intronic
1085008590 11:73118560-73118582 ATGGATACACACATCAATGTGGG - Intronic
1085470596 11:76755060-76755082 ATATATATACACATATATCTGGG + Intergenic
1085776877 11:79374566-79374588 ATATATCTACACATAAACCTTGG + Intronic
1086009844 11:82088108-82088130 ATACATACACACATATTTCTAGG - Intergenic
1086259881 11:84926357-84926379 ACACATACACACATATATCTGGG - Intronic
1086823031 11:91459406-91459428 ATAAAGACACACCTGAAACTGGG + Intergenic
1087255661 11:95949608-95949630 ATATAGACATACCTGAAGCTGGG + Intergenic
1087433904 11:98089009-98089031 ATATACACAAACATGAGTGTAGG + Intergenic
1087495189 11:98882081-98882103 ATATATACACATATATATATGGG + Intergenic
1087838452 11:102897966-102897988 ATAAAGACACACCTGAAACTGGG - Intergenic
1087862707 11:103181535-103181557 ATACAAACACACATGCATATAGG - Intronic
1087976487 11:104555257-104555279 ATAGAAACACACATGAAACAAGG + Intergenic
1088295155 11:108285521-108285543 ATAAATACATACATAAATGTGGG - Intronic
1088589032 11:111386577-111386599 GTATATACACACAGGATTCATGG - Intronic
1088603903 11:111511050-111511072 AAATATACATACATGAAACTAGG - Intronic
1089877945 11:121744094-121744116 CTATGTAGACACAGGAATCTAGG - Intergenic
1090487106 11:127123205-127123227 ACAAATACACAAATGACTCTAGG - Intergenic
1090692469 11:129198684-129198706 ATAAAGACATACATGAAACTGGG - Intronic
1092652108 12:10646050-10646072 ATAAAGACATACATGAAACTGGG - Intronic
1092664992 12:10785923-10785945 ATATATAAAAACATGTATATAGG + Intergenic
1093273122 12:17090769-17090791 ATATATACAGGCAAGAATTTTGG + Intergenic
1093756600 12:22859849-22859871 AAATATACAATCATGAATTTAGG + Intergenic
1093833547 12:23797315-23797337 GGATATACACAGATGTATCTTGG + Intronic
1093869511 12:24270999-24271021 ATATATACACATATTTCTCTAGG + Intergenic
1093878942 12:24382134-24382156 GTATATACACACATTAAGTTAGG + Intergenic
1093933075 12:24973644-24973666 ATAAATACACACTTAAATGTGGG + Intergenic
1094443438 12:30504464-30504486 AGATTTAAACACATGAATTTGGG + Intergenic
1094677109 12:32631353-32631375 ATATATTCACTCATGACACTGGG - Intronic
1094733289 12:33202623-33202645 ATATATAAACATGTGAAGCTTGG - Intergenic
1095222472 12:39633288-39633310 ACAAATACACATATTAATCTAGG + Intronic
1095539410 12:43291109-43291131 ATATACACACACATGCCTTTGGG + Intergenic
1096945117 12:55397313-55397335 ATATATACACATATGTATATAGG + Intergenic
1096947480 12:55422989-55423011 ATAGACACACAAATGCATCTTGG - Intergenic
1097594714 12:61614880-61614902 ATACATATATACATGCATCTGGG - Intergenic
1098321135 12:69244726-69244748 AGATATACACACATTAACCTAGG + Intronic
1098625572 12:72661657-72661679 ATATATACACACATATATAAAGG - Intronic
1098797170 12:74904259-74904281 ATATATACATATATATATCTTGG + Intergenic
1098939672 12:76519587-76519609 ATAAATACATACCTGAATCTGGG + Intronic
1099089234 12:78283678-78283700 AAATATACACAAATTAATCAAGG - Intergenic
1099106398 12:78502050-78502072 ATATATACACACATATATGGAGG + Intergenic
1099301773 12:80904652-80904674 ATACATACACAATTGAATATAGG + Intronic
1099313223 12:81053637-81053659 ATTCATACACACATGTATATAGG + Intronic
1099463933 12:82959083-82959105 ATATACACACACAAAAATATAGG + Intronic
1099537958 12:83868534-83868556 ATATTTTCAAAGATGAATCTGGG + Intergenic
1099735987 12:86566633-86566655 ATATATACATAAATGTATATAGG + Intronic
1099995336 12:89771961-89771983 ATTTATACAGACAGAAATCTGGG - Intergenic
1101181635 12:102225489-102225511 ACAAATACAGACATAAATCTGGG - Intergenic
1101392240 12:104312016-104312038 ATATATACACACATATATATGGG + Intronic
1101451546 12:104784332-104784354 ATAGATACACACATATATATAGG + Intergenic
1102817666 12:115880827-115880849 ATATTTCAACACATGAATTTTGG - Intergenic
1103108013 12:118247302-118247324 ATATATACATACATAAATGTAGG - Intronic
1104094565 12:125545186-125545208 ATTTATACAAACATTAACCTTGG - Intronic
1105383542 13:19909839-19909861 ATTTATACAGACAAAAATCTGGG + Intergenic
1105384919 13:19920723-19920745 ATACATACACACATAAATGAAGG - Intergenic
1106748960 13:32737873-32737895 ATATCTACTCTCTTGAATCTTGG + Intronic
1107739715 13:43436789-43436811 ATATAAACACACAGGTATCAGGG + Intronic
1107765821 13:43733417-43733439 CTCTATGCACAAATGAATCTTGG + Intronic
1107820223 13:44279102-44279124 AAATATACCAACATAAATCTGGG + Intergenic
1107877520 13:44803822-44803844 AGAGATACACACAGGAACCTGGG - Intergenic
1108437756 13:50417292-50417314 TTTTTTGCACACATGAATCTGGG + Intronic
1108786417 13:53908060-53908082 ATATATTCGCACATGTATCTTGG + Intergenic
1108948676 13:56058986-56059008 ATATATACACATATATATATAGG + Intergenic
1109393325 13:61721736-61721758 ATATATACACACATACACATAGG - Intergenic
1109776644 13:67049528-67049550 ATATATACATATATGCCTCTTGG - Intronic
1110544403 13:76740014-76740036 AGATATACACAGATATATCTTGG - Intergenic
1110581219 13:77130431-77130453 ATATATGTACAGATGAATGTGGG + Intronic
1110898169 13:80783629-80783651 ATATCTAAACTCATGTATCTAGG - Intergenic
1111216505 13:85149607-85149629 ATATATACACATATGTATTCTGG - Intergenic
1111224398 13:85251001-85251023 ATATATATAAACATGCATATAGG + Intergenic
1111667332 13:91285746-91285768 AGTTATTCAAACATGAATCTAGG + Intergenic
1111884922 13:94008329-94008351 CTATATACACTCATGAACATTGG + Intronic
1112608608 13:100932508-100932530 AAATAGAAACACATGACTCTGGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112833636 13:103485628-103485650 ATATATAAACACATGTTCCTGGG - Intergenic
1113219867 13:108087498-108087520 ATATATATACACAAGGGTCTTGG - Intergenic
1114198447 14:20500226-20500248 ACATTTACACACATAAACCTAGG + Intergenic
1114661399 14:24347478-24347500 ATATATACACACTGGAGCCTAGG + Intergenic
1114694197 14:24611616-24611638 ATATATATATACATAAATATAGG - Intergenic
1115047751 14:29017983-29018005 ATATATACACACATGTATATAGG - Intergenic
1115975855 14:38996092-38996114 AGATGTACACACATAAATCTGGG - Intergenic
1116130049 14:40844375-40844397 ATATATATACACATATATGTGGG + Intergenic
1116246367 14:42418815-42418837 ATATTTAAAGCCATGAATCTGGG - Intergenic
1116258121 14:42584135-42584157 ATATATACACACATATATATGGG - Intergenic
1116348454 14:43827624-43827646 ATAAAGACACACCTGAGTCTGGG - Intergenic
1116351040 14:43863179-43863201 ATATATACACACATACATATAGG + Intergenic
1116691404 14:48111387-48111409 ATTGATACACAGATGACTCTTGG + Intergenic
1116793978 14:49369783-49369805 ATATATACACACACATATATAGG - Intergenic
1116793979 14:49369811-49369833 ATATACACACACATATATATAGG - Intergenic
1116890850 14:50266673-50266695 ATATATACATATGTGCATCTAGG - Intronic
1116949421 14:50865245-50865267 ATAGATACACAAATGTACCTAGG - Intronic
1117099178 14:52328381-52328403 AAATATAGACAGATGAATTTTGG - Exonic
1117847520 14:59927157-59927179 ATGTATACACACATGCCTATGGG + Intronic
1119150997 14:72359179-72359201 ATAAAGACATACATGAAACTGGG - Intronic
1119744082 14:77032205-77032227 ATATATACACACATACATGCTGG + Intergenic
1120243322 14:81975537-81975559 ATATACACACACACTAATCTTGG - Intergenic
1120255346 14:82111881-82111903 ATAGATACAAAAATGGATCTAGG - Intergenic
1120433412 14:84448643-84448665 ATATATACACACACATATATAGG + Intergenic
1120658413 14:87223547-87223569 ATATACACAAACATGTATCTTGG + Intergenic
1120676964 14:87431826-87431848 ATATATAAGAACATGAATTTTGG + Intergenic
1121062609 14:90929206-90929228 ATACATATACACATAAAACTTGG + Intronic
1122223418 14:100257458-100257480 AGATTTCAACACATGAATCTGGG - Intronic
1202937991 14_KI270725v1_random:110251-110273 ATATAAAGACACATGATTCTTGG - Intergenic
1123395203 15:19927642-19927664 ATAGAGACACATATGATTCTTGG + Intergenic
1123779374 15:23610328-23610350 ATACATACATACATTAGTCTAGG + Intronic
1123907997 15:24939411-24939433 ATATATACATACATAAAAATGGG - Intronic
1124472264 15:29998593-29998615 ATACATAAACACATGTTTCTGGG - Intergenic
1124910730 15:33917458-33917480 ATATATATACACATACATCATGG + Intronic
1125418457 15:39477805-39477827 ACATTTCCACACATGAATGTGGG + Intergenic
1125611440 15:40973819-40973841 AAATATACACACATGCAAATGGG - Intergenic
1126999814 15:54489474-54489496 ATATATACACACATACATTGAGG - Intronic
1128106269 15:65047382-65047404 ATATATACACACATTAAAAATGG + Intronic
1128859724 15:71057590-71057612 ATATATCCACAAATGAATGTGGG - Intergenic
1130089242 15:80805629-80805651 ATATATACAAACATAAAACTAGG + Intronic
1130365103 15:83229073-83229095 ATATATACACACATATATGATGG - Intergenic
1130602000 15:85282101-85282123 ATGTATACACACATATATATAGG - Intergenic
1131850667 15:96540247-96540269 TTATCTACACACAAGAACCTTGG + Intergenic
1132058920 15:98674801-98674823 ATAGATACACATATAAGTCTAGG - Intronic
1132100484 15:99019527-99019549 ATATATACACACATATATGAAGG + Intergenic
1132306055 15:100813493-100813515 ATTTACACAAACAGGAATCTGGG - Intergenic
1133311387 16:4848798-4848820 TTAAATAAAAACATGAATCTTGG + Intronic
1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG + Intergenic
1134784109 16:16925356-16925378 ATGTATACGGACATAAATCTAGG - Intergenic
1134918922 16:18097780-18097802 ATACAGACACACATGAGTGTGGG + Intergenic
1135110253 16:19685334-19685356 ATACCAACACAGATGAATCTTGG - Intronic
1135283356 16:21172031-21172053 ATTTATACACACTTGGAGCTGGG - Intronic
1135964423 16:27024088-27024110 ATACATACACACATATATATAGG - Intergenic
1136124816 16:28170543-28170565 ATACATACACACACAAAACTTGG - Intronic
1136244307 16:28964671-28964693 ACATATTCACACATGAAACGTGG - Exonic
1136770048 16:32829073-32829095 ATAAAGACACATATGATTCTTGG - Intergenic
1136870370 16:33802162-33802184 AAATACACACACATGAACCTTGG + Intergenic
1136936168 16:34466984-34467006 ATAAAGACACATATGATTCTTGG - Intergenic
1136948486 16:34686108-34686130 ATATAAAGACACATGATTCTTGG + Intergenic
1136963653 16:34881586-34881608 ATAAAGACACATATGATTCTTGG + Intergenic
1137088285 16:36156827-36156849 ATAAAGACACATATGATTCTTGG + Intergenic
1137092795 16:36216064-36216086 ATAAAGACACATATGATTCTTGG + Intergenic
1137220403 16:46443501-46443523 ATAAAGACACATATGATTCTTGG - Intergenic
1137515476 16:49139885-49139907 ATTTATAAATACATGAGTCTGGG + Intergenic
1138067094 16:53953669-53953691 ATATAAACACGTAGGAATCTTGG + Intronic
1138417245 16:56878420-56878442 ATCTTCACACTCATGAATCTGGG - Intronic
1138765728 16:59600903-59600925 ATAAACACAGACTTGAATCTAGG - Intergenic
1138906709 16:61344623-61344645 ATAGAAACACATATAAATCTAGG + Intergenic
1138944707 16:61834826-61834848 ATATATTATCACATGAATATTGG + Intronic
1139043640 16:63030643-63030665 ATATATAGACTCATGAATAAGGG + Intergenic
1139712502 16:68787111-68787133 ATATAAACACGCATCAATCTAGG - Intronic
1140008893 16:71110223-71110245 ATATATACACACATACATACAGG - Intronic
1140245808 16:73247009-73247031 TTATATACACACACGCATATAGG - Intergenic
1140283027 16:73572926-73572948 AGATATACAAAGATGAATATAGG - Intergenic
1140413696 16:74758024-74758046 ATATATATACGCATGTATATGGG + Intronic
1141044337 16:80703028-80703050 ATATATACACACATGAATCTAGG + Intronic
1141045402 16:80711940-80711962 ATATACACACACATATATATGGG - Intronic
1141211924 16:81989355-81989377 ATATATACATATATGAAATTTGG + Exonic
1203072468 16_KI270728v1_random:1091177-1091199 ATAAAGACACATATGATTCTTGG - Intergenic
1203101802 16_KI270728v1_random:1313888-1313910 AAATACACACACATGAACCTTGG - Intergenic
1142636494 17:1260684-1260706 ATATATACACACAAGATTCCTGG - Intergenic
1143743172 17:8968881-8968903 ATATATACATTCATTTATCTTGG - Intergenic
1144180707 17:12749584-12749606 ATATATACACACATATATATAGG - Intronic
1144180708 17:12749624-12749646 ATATATACACACGTATATATAGG - Intronic
1144246299 17:13369189-13369211 ATATATACACACACGCACCATGG - Intergenic
1145831269 17:27918282-27918304 ATGTAATCAAACATGAATCTAGG - Intergenic
1146226783 17:31073985-31074007 CTATATATACTAATGAATCTTGG + Intergenic
1147683146 17:42267452-42267474 ATAAACACACACATTAGTCTAGG - Intronic
1149138586 17:53401713-53401735 ATATATACGCACAAAAAACTTGG - Intergenic
1149796343 17:59524066-59524088 ATATATACACATTTGGCTCTTGG - Intergenic
1150546898 17:66168376-66168398 ATATACACACACATATATATAGG - Intronic
1150854451 17:68737641-68737663 ATATACACACACACACATCTAGG - Intergenic
1151093120 17:71465143-71465165 ATACACACACACACCAATCTAGG + Intergenic
1151409609 17:73913180-73913202 ATAGAAGCACACATCAATCTGGG + Intergenic
1152285824 17:79412806-79412828 ATATACACACACATGCATAGAGG - Intronic
1152939156 17:83157540-83157562 ATATATACACATATATATATTGG + Intergenic
1153017028 18:592578-592600 ATATACACACATATGTATGTGGG + Intergenic
1154250579 18:12740904-12740926 ATATACACACACATACATATAGG + Intergenic
1154983514 18:21524999-21525021 ATATATATACACACAAATCATGG - Exonic
1155232571 18:23787975-23787997 ATACATACATACATAAATATGGG + Intronic
1155569702 18:27178993-27179015 ATGTATACACACATAATTTTAGG - Intronic
1155627374 18:27850206-27850228 TTAGATAGACACATAAATCTAGG + Intergenic
1155732817 18:29182340-29182362 ACACATACACACATGGATATGGG - Intergenic
1155912356 18:31518583-31518605 ATATATACACAGATGCATAAAGG - Intronic
1156089609 18:33450354-33450376 ACAAATACACACATTAACCTAGG + Intergenic
1156475025 18:37400301-37400323 ATATATACACACATATATAAAGG - Intronic
1156801680 18:41122389-41122411 ATAAATACACACCTGAAACTGGG - Intergenic
1156957585 18:42987188-42987210 GTATACACACACATGTATCATGG + Intronic
1156973868 18:43192839-43192861 ATATATACACACATATATATGGG + Intergenic
1157317770 18:46607434-46607456 ATATATACACACATATATATGGG + Intronic
1157333725 18:46721989-46722011 ATAAATACAGACATGCATGTCGG + Intronic
1157341965 18:46786924-46786946 ATAAATACACACAGGAATGTGGG + Intergenic
1157550675 18:48579819-48579841 ATATACACACACACTAATGTGGG - Intronic
1158384487 18:56974177-56974199 ATATGTACACACATGAAATTAGG - Intronic
1158626289 18:59074440-59074462 ATTTATAGACACATGCATATTGG - Intergenic
1158778730 18:60619918-60619940 ATATATGCACACAGGTATCAAGG - Intergenic
1158798574 18:60878270-60878292 ATATATACACACATACAATTTGG + Intergenic
1158926168 18:62263555-62263577 ATATACACACACATAAAATTTGG + Intronic
1159070373 18:63616290-63616312 ATATATACACACACATATCTAGG + Intergenic
1159256759 18:65956984-65957006 ATACATACACACCAGAATCAGGG - Intergenic
1159276884 18:66233189-66233211 ATGTATATAAACAGGAATCTAGG + Intergenic
1159303491 18:66609275-66609297 ATATATACACATATATATGTGGG - Intergenic
1159433505 18:68385382-68385404 ATAAAGACACACCTGAAACTGGG - Intergenic
1159519578 18:69500899-69500921 ATTTATAAACACATGTATTTTGG + Intronic
1159850102 18:73516942-73516964 ATATATACACATATATATCAGGG + Intergenic
1160058241 18:75506650-75506672 ATATGTCCACATATGTATCTGGG - Intergenic
1160114848 18:76068219-76068241 ATATATACACAGATCAGGCTGGG - Intergenic
1160609937 18:80077041-80077063 ACATTTCAACACATGAATCTGGG + Intronic
1161669607 19:5598627-5598649 ACAGACACACACATGAATCCTGG - Intronic
1162687201 19:12397727-12397749 ATATATGTACATATGAATCCAGG + Intronic
1162982794 19:14249597-14249619 AATTATACATACATAAATCTGGG + Intergenic
1163741878 19:19019595-19019617 AAATATACAAAAATGTATCTAGG + Intronic
1164142896 19:22489271-22489293 ATATATATACATATGTATATAGG - Intronic
1164280031 19:23761019-23761041 ATATATATACACATATATATAGG + Intergenic
1164499525 19:28804560-28804582 GTATGTACACACATGTATATAGG - Intergenic
1164499536 19:28805605-28805627 ATATATACACATATGTATATAGG + Intergenic
1167403359 19:49287721-49287743 ATAAATACATACCTGAAACTGGG - Intergenic
1167633864 19:50642117-50642139 ATGTAAACACACATCCATCTGGG - Intronic
1168186008 19:54699819-54699841 ATATATTCACACATAAATATAGG + Intronic
925748059 2:7061234-7061256 ATATTTACACAAATGAGTTTGGG - Intronic
926017220 2:9464362-9464384 ATATATACACACGTAAACTTTGG + Intronic
926379579 2:12272684-12272706 ATATATATACACACTAACCTTGG - Intergenic
926432519 2:12802859-12802881 GTATATACACAAAGGAATGTGGG + Intergenic
926537114 2:14127058-14127080 ATATATTAACATATGAATTTTGG - Intergenic
926989500 2:18662421-18662443 GAATATACACACATGAATCATGG - Intergenic
927346636 2:22051632-22051654 ATGTATAGACACATGGGTCTAGG - Intergenic
928144531 2:28760108-28760130 ATATACACACACATTAGCCTAGG - Intronic
928297775 2:30099781-30099803 ATATATACACACATACACCATGG - Intergenic
928808575 2:35193599-35193621 ATATATACACACATACACCATGG + Intergenic
929177498 2:38995838-38995860 ATACATACACAAATGAAAATTGG - Intronic
929326805 2:40623335-40623357 GTATACACATAGATGAATCTTGG + Intergenic
929369952 2:41210856-41210878 ATATATACACACATAGATATTGG + Intergenic
930189065 2:48439843-48439865 ATATATACATATATAGATCTAGG + Intergenic
930443440 2:51438671-51438693 ATATATACACACACATATATAGG - Intergenic
930447584 2:51494352-51494374 ATATATACATATATGCATATAGG - Intergenic
931565262 2:63609387-63609409 ATATATACACACACTAATAAAGG + Intronic
931704300 2:64934450-64934472 ATTTTTACACAGAAGAATCTAGG - Intergenic
933346598 2:81093935-81093957 ATATATACACACAAGGTCCTAGG - Intergenic
934468563 2:94289472-94289494 ATAAAGACACATATGATTCTTGG - Intergenic
934791233 2:97062487-97062509 ATATATATAAACATTAATGTAGG + Intergenic
934815208 2:97320043-97320065 ATATATATAAACATTAATGTAGG - Intergenic
934822487 2:97388440-97388462 ATATATATAAACATTAATGTAGG + Intergenic
936899806 2:117469965-117469987 ACACACACACAAATGAATCTTGG + Intergenic
937390703 2:121483592-121483614 ATACACACACACAAGAATTTGGG + Intronic
938055691 2:128213016-128213038 ATATATATATCCATGAGTCTGGG + Intergenic
938546652 2:132339000-132339022 ATACATACACGCAAGTATCTAGG - Intergenic
939112948 2:138029851-138029873 ATATTTAGACACATTAAACTTGG - Intergenic
939134409 2:138276386-138276408 ATTTATACATACATGAACATAGG + Intergenic
939454193 2:142411766-142411788 ATATACACACACATAAAATTTGG - Intergenic
939860603 2:147415648-147415670 ATACATACACACATACATGTAGG - Intergenic
940174240 2:150861023-150861045 ATAAAGACACACATGAGACTGGG - Intergenic
940477248 2:154178492-154178514 ATATATACACATGTGCATGTTGG - Intronic
940518019 2:154705327-154705349 ACATATACATACATGATCCTAGG - Intronic
940671482 2:156674729-156674751 AAATATACACACGTGCATGTGGG + Intergenic
940747406 2:157583927-157583949 ATAAAAACACATATGAATTTTGG + Intronic
941074883 2:160995589-160995611 ACATAAACACACATTAGTCTAGG - Intergenic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
941880945 2:170479987-170480009 ATACATACACACATATATATAGG - Intronic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
942010195 2:171754528-171754550 ATATATACACACACAGATGTGGG + Intergenic
942550504 2:177111030-177111052 ATATATATACACATATATATGGG - Intergenic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
942858243 2:180578010-180578032 ATATATAAACACAAAAATTTTGG - Intergenic
943184206 2:184585634-184585656 ATATATACCCAGAAGAATATAGG - Intergenic
943219490 2:185087081-185087103 ATTTAATCAAACATGAATCTAGG + Intergenic
943331074 2:186559887-186559909 ATATGTAAACACATGAATGAAGG + Intergenic
943381961 2:187161224-187161246 ATATATATATATATGAATCTGGG + Intergenic
943402737 2:187435796-187435818 TTATATACACAAAGGAATTTTGG + Intronic
943914050 2:193605386-193605408 ATAAAGACACACCTGAGTCTGGG + Intergenic
944897834 2:204183615-204183637 ATATGTACACACAAGGATCAAGG - Intergenic
945008502 2:205436242-205436264 GTATATCAACACATGAATTTTGG + Intronic
945257711 2:207815937-207815959 ATACATACATACATAAATGTAGG - Intergenic
945443060 2:209903665-209903687 ATATATACACACATGGTTAGAGG + Intronic
945598467 2:211826938-211826960 ATATATACACACATGCAAAAGGG - Intronic
947154918 2:227152927-227152949 ATAAATACACACCTGAGACTGGG + Intronic
947836262 2:233178019-233178041 ATATATACACATATATATTTGGG + Intronic
1169043555 20:2517351-2517373 ATATATACACACATATACATTGG - Intronic
1169840562 20:9931254-9931276 ATATATACCCACATGCAATTTGG + Intergenic
1170125180 20:12955150-12955172 ATATATATACACACATATCTAGG - Intergenic
1170749235 20:19130624-19130646 ATACATTCACACAGGAATCTTGG + Intergenic
1171002781 20:21431434-21431456 ATATATTCACAAATGTATCTTGG - Intergenic
1171047574 20:21825319-21825341 ATATATGCACACACACATCTTGG - Intergenic
1171570203 20:26242557-26242579 ATATATAGATATATGAATTTGGG + Intergenic
1171875514 20:30571734-30571756 ATACATACACGCAAGTATCTAGG - Intergenic
1172194972 20:33085459-33085481 ATAAATACATAAATAAATCTGGG + Intronic
1176585327 21:8578888-8578910 ATAAAGACACATATGATTCTTGG + Intergenic
1176709876 21:10141121-10141143 ATATATATACACATATATATTGG + Intergenic
1177069410 21:16484652-16484674 ATATATATACACATATATATAGG + Intergenic
1177342389 21:19821054-19821076 ATATATACACACACACATATAGG - Intergenic
1177353004 21:19970209-19970231 TAATATACACACATTAATATAGG + Intergenic
1177475235 21:21611703-21611725 ATAAATAAACACCTGAAGCTGGG - Intergenic
1177599380 21:23290204-23290226 ATAAAGACATACATGAAACTGGG - Intergenic
1177603637 21:23349510-23349532 ATATGTACACACCTCAGTCTGGG - Intergenic
1177615388 21:23510802-23510824 ATATACATACACATGTATATGGG - Intergenic
1177680638 21:24364608-24364630 ACATATACACACATGCATGGAGG + Intergenic
1177949440 21:27516508-27516530 ATATTTAAACACTTGAATTTAGG + Intergenic
1178183689 21:30194339-30194361 AAATTCACAAACATGAATCTTGG - Intergenic
1178459327 21:32787997-32788019 ATAAAGACACACATGAGACTGGG + Intergenic
1179312728 21:40210862-40210884 ACATACACACAAATGAATGTGGG - Intronic
1179458506 21:41516422-41516444 ATTTATACAAACAGGAATCCAGG - Intronic
1180080404 21:45484660-45484682 ACATACACACACATGTATCTAGG + Intronic
1180268135 22:10555787-10555809 ATAAAGACACATATGATTCTTGG + Intergenic
1181048032 22:20224959-20224981 ATACATGCACACATGAACATGGG + Intergenic
1181799732 22:25337341-25337363 ATATATAGAAACCTCAATCTGGG + Intergenic
1182328907 22:29536412-29536434 ATATATACACACATTGACCTGGG - Intronic
1182330005 22:29545011-29545033 ATAAAGACACACCTGAAACTGGG + Intronic
1183952470 22:41359244-41359266 ATATATACACACTAGAAACAAGG - Exonic
1184635604 22:45826428-45826450 ATATATACAACCAGGAAACTCGG + Intronic
1203237179 22_KI270732v1_random:16229-16251 ATATAAAGTCACATGATTCTTGG + Intergenic
1203323434 22_KI270737v1_random:91674-91696 ATAAAGACACATATGATTCTTGG - Intergenic
949224307 3:1675013-1675035 ATATACACACACATATATATAGG - Intergenic
949240109 3:1860948-1860970 ATATAATCACAGATGAACCTCGG - Intergenic
949752124 3:7365687-7365709 ATATATATACACATATATATGGG + Intronic
950190922 3:10975519-10975541 ATAAAGACAGACATTAATCTAGG + Intergenic
951011593 3:17688233-17688255 ATATATATACACATACATATAGG + Intronic
951410599 3:22360581-22360603 AAATAAACAGCCATGAATCTTGG - Intronic
951916469 3:27805917-27805939 ATACATACACACATAAATGTGGG - Intergenic
952296249 3:32064846-32064868 AAAAAAACACACATGTATCTAGG - Intronic
954923112 3:54208826-54208848 ATAAATACATACATGAGACTGGG + Intronic
955501551 3:59589511-59589533 TTGTATACATACATGAGTCTTGG - Intergenic
956020766 3:64931143-64931165 TTATATACACACATTACTTTGGG + Intergenic
956030413 3:65031057-65031079 ATATATACTCAGATGACTCATGG - Intergenic
956147753 3:66208670-66208692 ATATATATACACATTTATATGGG + Intronic
956147755 3:66208696-66208718 ATATATATACACATTTATATGGG + Intronic
956147757 3:66208722-66208744 ATATATATACACATTTATATGGG + Intronic
956147775 3:66208959-66208981 ATATATACACACCTTTATATGGG - Intronic
956380918 3:68663630-68663652 ATACATACACACCTGACTCCAGG + Intergenic
956660285 3:71590730-71590752 ATATATACACATATACATGTGGG - Intergenic
956790586 3:72677120-72677142 ATATTAACACTAATGAATCTGGG - Intergenic
956993079 3:74791452-74791474 ATATTTCAACATATGAATCTGGG + Intergenic
957016572 3:75070681-75070703 ATATACACACACATATATATTGG + Intergenic
957298812 3:78364546-78364568 ATTTATACAGACAAAAATCTGGG - Intergenic
957446761 3:80322496-80322518 ATCTATACACACACGTATATGGG + Intergenic
957563190 3:81851723-81851745 GTATATACACACATATATGTAGG + Intergenic
957711158 3:83860939-83860961 ATAAATACACACCTGAGACTGGG + Intergenic
958076417 3:88686569-88686591 ATATACACACACATATAACTTGG + Intergenic
958110802 3:89141739-89141761 ATATATACACACATACGTCTAGG + Intronic
958746798 3:98145606-98145628 ATATATACACAAAGGAAATTAGG + Intergenic
958839214 3:99183191-99183213 TTTTATACACAAATGCATCTAGG - Intergenic
959423403 3:106155425-106155447 ATATATACACACACACATTTTGG - Intergenic
959745183 3:109768166-109768188 ATATATACACACTTATATATAGG - Intergenic
960470560 3:118059809-118059831 ATTTGAACAAACATGAATCTAGG - Intergenic
960568682 3:119163915-119163937 CTATACACACACATATATCTAGG - Intronic
960902454 3:122565812-122565834 ACATATACACACATAAAAATGGG - Intronic
963393551 3:144702037-144702059 ATATATATACACATCAATTATGG + Intergenic
963450595 3:145476407-145476429 ATATATACAGAAATAAATATAGG + Intergenic
963524526 3:146400773-146400795 ATATATACACACACGGAGCTAGG - Intronic
963678372 3:148343198-148343220 ATATAAAAATACATGAAACTGGG - Intergenic
964303232 3:155312060-155312082 TTATATACATACAGGAATCTAGG + Intergenic
964407218 3:156361447-156361469 ATATATACACACACATATCAAGG - Intronic
964994406 3:162857343-162857365 ATATGTACACTGATGAATGTGGG - Intergenic
965299500 3:166991965-166991987 ATATATACACAAATTAATTCTGG + Intergenic
965704019 3:171487729-171487751 ATATATAACGACATAAATCTGGG + Intergenic
965793003 3:172410172-172410194 ATATACACACACACCAAACTAGG + Intergenic
966006015 3:175012954-175012976 ATATATATACACACACATCTAGG - Intronic
966159208 3:176950291-176950313 AAACATAAACACATGAATTTGGG + Intergenic
966763216 3:183435328-183435350 ATTTATACAGACAAAAATCTGGG + Intergenic
966791603 3:183676144-183676166 ATCTATGCACACATTGATCTCGG + Intronic
967480759 3:189970313-189970335 ATATATACACACATACCTATAGG + Intronic
968024501 3:195428306-195428328 ATATATACACTCATATATATAGG + Intronic
968263989 3:197348449-197348471 ATATATACACACACATATGTGGG + Intergenic
968387764 4:158043-158065 ATATATACACACATTTGTCATGG + Intronic
968719372 4:2188832-2188854 ATATAAAAACACATAAATCGAGG + Intronic
968807015 4:2780572-2780594 ACACATACACACATATATCTTGG + Intergenic
969287178 4:6210320-6210342 ATATATACATACATACATATGGG + Intergenic
969822372 4:9730523-9730545 ACATGGACGCACATGAATCTGGG - Intergenic
969954737 4:10877287-10877309 ATTCATACACACTTGAATGTGGG + Intergenic
970279022 4:14433699-14433721 ATACATAAACAAATGAATATGGG + Intergenic
970398907 4:15699525-15699547 ATAAAGACACACCTGAAACTGGG + Intronic
971043048 4:22776552-22776574 ATATACACACACATATATATGGG + Intergenic
971139776 4:23911730-23911752 ATATATACTAACATGCATATTGG + Intergenic
971458226 4:26864696-26864718 ATATATAAAAACATGTTTCTTGG + Intronic
971508359 4:27391732-27391754 TTATATACACAAAGGAATCCAGG - Intergenic
971597486 4:28549506-28549528 ATATATAAACTCACAAATCTGGG + Intergenic
971871140 4:32240464-32240486 ACAAAGACATACATGAATCTGGG - Intergenic
972057698 4:34825710-34825732 ATAAAGACATACCTGAATCTGGG + Intergenic
972168881 4:36320930-36320952 ATATTTACATATATGTATCTAGG + Intronic
972546417 4:40084599-40084621 ATATATACACACACAAAATTTGG - Intronic
972807060 4:42539595-42539617 AAAAATAGACACATAAATCTAGG + Intronic
973275737 4:48306078-48306100 ATATATACAAACATTATTTTGGG + Intergenic
973926777 4:55747038-55747060 ATATAGAAACACATCAATTTGGG + Intergenic
974012917 4:56623831-56623853 ATAAAAACATACATGAAACTGGG - Intergenic
974286503 4:59875617-59875639 CTATATACACATAGGAATATGGG + Intergenic
974335382 4:60537266-60537288 CTATCTACACACATGTACCTGGG + Intergenic
974404312 4:61446153-61446175 ATATATACACACATATGTCCAGG - Intronic
974584982 4:63862075-63862097 ATAGAAACACACATGTATCTAGG + Intergenic
974720511 4:65732184-65732206 ATATATACACACATATATATAGG + Intergenic
975428789 4:74263086-74263108 ATATATACACATATATATATAGG - Intronic
975879724 4:78889729-78889751 GTATATACACACATACACCTGGG - Intronic
977158749 4:93608150-93608172 ATATATACACATATGTATTCTGG + Intronic
977310307 4:95378100-95378122 ATATATAAACTACTGAATCTTGG - Intronic
977435345 4:96988445-96988467 ATAAATACACACCTGAGACTGGG - Intergenic
977542491 4:98334253-98334275 ATACATACACACAAAAATTTTGG + Intronic
977692667 4:99933236-99933258 ATATATACACACACTCAACTAGG + Intronic
978027331 4:103893523-103893545 ATATATACACACCAGAAATTTGG - Intergenic
978071820 4:104481659-104481681 ATATACACACACACAAATCCTGG - Intronic
978302493 4:107287052-107287074 ATACACACACACATAAATATGGG - Intergenic
978725941 4:111969499-111969521 ATACATACATACATGAACATGGG + Intergenic
978918414 4:114152129-114152151 ATTTATACAGACAGAAATCTGGG + Intergenic
979150998 4:117314023-117314045 ATTTGTACACAAATGAATTTTGG + Intergenic
979262091 4:118660012-118660034 ATATATACACACATATACATAGG - Intergenic
979289775 4:118966654-118966676 ATATACACACACATACTTCTGGG + Intronic
979391577 4:120134841-120134863 CTATATACACACATGTAGATAGG - Intergenic
979438859 4:120727282-120727304 ATATATACATACATCTTTCTTGG - Intronic
979549194 4:121971546-121971568 ATATATACCCACATGTATAAAGG + Intergenic
979915319 4:126425016-126425038 ATATATACACAATAGAATATTGG + Intergenic
980782299 4:137507064-137507086 ATATACACACACACAAATATGGG + Intergenic
980788463 4:137586301-137586323 ATACATACATACATAAATATAGG + Intergenic
980880146 4:138701576-138701598 AAATCTAAACACATGAATTTAGG + Intergenic
980901146 4:138906411-138906433 ATATATACAACCCTGAAACTGGG + Intergenic
981241819 4:142486099-142486121 ATATAGTCACACAGGGATCTAGG - Intronic
981437539 4:144743613-144743635 ATATATACACACATGTATTTTGG - Exonic
981834436 4:149039113-149039135 ATATATACACACACATATATGGG - Intergenic
981918205 4:150057658-150057680 ATAGAGACACACCTGAAACTGGG - Intergenic
982090710 4:151877735-151877757 ATATATACACACACAAAGGTAGG - Intergenic
983796690 4:171872952-171872974 ATAGATACACAAATGAATTATGG + Intronic
983826742 4:172271592-172271614 ATATATACACACCTATATATAGG + Intronic
983859280 4:172685187-172685209 GAATATACATACATGAATCTCGG - Intronic
984226913 4:177046112-177046134 ATATAATCAAATATGAATCTGGG + Intergenic
984272347 4:177562526-177562548 ATATATATACACATATATGTAGG - Intergenic
984345346 4:178515566-178515588 ATATGTACACACATGAACTGTGG + Intergenic
984602470 4:181744281-181744303 ACATACCCACACATGTATCTTGG + Intergenic
985198299 4:187456901-187456923 ATCTACACTCACATGGATCTTGG + Intergenic
986059631 5:4175743-4175765 CTATATAAACACATGAAACAGGG - Intergenic
986294515 5:6426544-6426566 ATATATACACACACACATATAGG - Intergenic
986575624 5:9209817-9209839 TTATAGAAACACATAAATCTGGG + Intronic
986965479 5:13265891-13265913 GTATATATACACATGTATATAGG - Intergenic
987577121 5:19744092-19744114 ATATATACACTCATTACTATAGG - Intronic
987884072 5:23790142-23790164 ATATATACACACACACATCCTGG + Intergenic
988291382 5:29292534-29292556 ATATATACAAACATATATATGGG + Intergenic
989264909 5:39462284-39462306 ATGTATGCACACATGAAACATGG - Intronic
989408291 5:41086982-41087004 ATAAATACATATAAGAATCTTGG - Intergenic
990077975 5:51874181-51874203 ATAAATACATACCTGAAACTGGG - Intergenic
990094363 5:52093391-52093413 ATACACACACACATGCATATGGG + Intergenic
990128677 5:52551735-52551757 ATATCCACCCACTTGAATCTGGG - Intergenic
990524467 5:56611120-56611142 ATAAAGACACACCTGAAACTGGG + Intergenic
990677148 5:58200137-58200159 TTATATGCAGACATGAATATGGG - Intergenic
991064261 5:62409097-62409119 TTATAAACAAAAATGAATCTAGG + Intronic
991287513 5:64994791-64994813 GTATGTACACACATAATTCTAGG - Intronic
991339419 5:65591634-65591656 ATATATATATAAAGGAATCTTGG - Exonic
992456506 5:76921121-76921143 ATATATAGATACATGGACCTAGG - Exonic
992739034 5:79754602-79754624 TGATAAACAAACATGAATCTAGG + Intronic
992833309 5:80616443-80616465 ATGTAAACAATCATGAATCTAGG + Intergenic
993325953 5:86536906-86536928 ATACATATACAAATGAATTTAGG + Intergenic
994066493 5:95548908-95548930 ATACATACCCTCATGAATGTTGG - Intronic
994116666 5:96068852-96068874 ATATATACACACAGGAAGACAGG - Intergenic
994319830 5:98380970-98380992 ATATTTACATACATGATGCTTGG + Intergenic
994339013 5:98603427-98603449 ATATATACACACACATATCATGG + Intergenic
994564810 5:101430165-101430187 ATATATACACATATATATATGGG - Intergenic
994593237 5:101798547-101798569 ATATAGACAGACATGAACATGGG - Intergenic
994828787 5:104749620-104749642 ATATATAGACACATATATATTGG - Intergenic
995123009 5:108555102-108555124 ATATTTATCCACTTGAATCTGGG - Intergenic
995983859 5:118143959-118143981 ATATATATACACATGTAAATAGG - Intergenic
996488897 5:124068866-124068888 ATTTATACAGGCAGGAATCTGGG - Intergenic
996622195 5:125520620-125520642 ATAAAGACACACCTGAAACTGGG + Intergenic
996657792 5:125962196-125962218 ATATATAGACAGATAAATGTAGG + Intergenic
997317179 5:132946463-132946485 ATATATACACACATACATAATGG + Intronic
998578846 5:143348807-143348829 ATAGAAACACACATGAAACAAGG + Intronic
998984823 5:147744743-147744765 CTATATCCACACAAGGATCTGGG - Intronic
999467286 5:151819681-151819703 ATGTATCCACACATCCATCTTGG + Intergenic
999622424 5:153486649-153486671 ATATATACACACACATATATGGG - Intergenic
1000567499 5:162867843-162867865 ATACATACATACGTGAAACTGGG - Intergenic
1000621903 5:163495413-163495435 ATTTATACAGACAAAAATCTGGG - Intergenic
1000808097 5:165822919-165822941 ATAAAACCACTCATGAATCTAGG - Intergenic
1002952384 6:1827182-1827204 ATATATACATATATGTATCCTGG + Intronic
1004457202 6:15802191-15802213 ATTTAATCAAACATGAATCTAGG - Intergenic
1005124983 6:22436766-22436788 AGACACACACACATGAACCTAGG + Intergenic
1005689086 6:28284431-28284453 ATACATATACATATGCATCTTGG - Intronic
1006526901 6:34614120-34614142 AAATAAACATACATGAATCCTGG + Intronic
1008367201 6:50695542-50695564 ATACACACACACATGCTTCTCGG + Intergenic
1008424456 6:51340724-51340746 ATATATACACACATGTATAAAGG + Intergenic
1008451605 6:51657701-51657723 ATATATACACACATATATGTGGG - Intronic
1009958529 6:70488379-70488401 ACATATACACATATGAGTTTTGG - Intronic
1010182955 6:73108994-73109016 GTATATACACACATAAAACATGG - Intronic
1010188809 6:73173595-73173617 ACATATATATACATGAATCTTGG + Intronic
1010451323 6:76006505-76006527 ATATATACCCATATGTATATAGG - Intronic
1010712916 6:79196117-79196139 ATAAAGACATACATGAACCTGGG + Intergenic
1010853861 6:80813451-80813473 GTATATATTCACATAAATCTAGG + Intergenic
1010871075 6:81040548-81040570 ATATATACATACATGTTTTTAGG - Intergenic
1011100686 6:83718286-83718308 ATATACACACACATATATATAGG + Intergenic
1012013162 6:93818711-93818733 ATATTTACACACATGAATGATGG - Intergenic
1012021276 6:93923424-93923446 ATATATCTCCACATGGATCTTGG - Intergenic
1012764139 6:103342855-103342877 ATACATACACACATGCATCAGGG - Intergenic
1012895183 6:104939975-104939997 ATATATACACATATTTAGCTTGG - Intergenic
1013199804 6:107882493-107882515 TTATATACACCCATGAAACAAGG + Intronic
1013674880 6:112447680-112447702 ATAAATACATACATTAACCTAGG + Intergenic
1013922138 6:115418774-115418796 ATATATACACACACACATTTTGG - Intergenic
1014142329 6:117958093-117958115 ACAAATACACACATTAGTCTAGG - Intronic
1014355977 6:120410739-120410761 TTATATACACAGATGTATGTAGG + Intergenic
1014794489 6:125708401-125708423 ATATGTATTCACATGTATCTTGG - Intergenic
1014984908 6:127993291-127993313 ATAGATACACACATATATATAGG + Intronic
1015011559 6:128355512-128355534 ATATACACACACATGCATGTGGG + Intronic
1016165733 6:140939839-140939861 AAGTATACACACATAATTCTAGG - Intergenic
1016186253 6:141201088-141201110 ATATACACACACATATATCATGG + Intergenic
1016698528 6:147027336-147027358 ACATATACACACAGGTTTCTGGG - Intergenic
1016734309 6:147459968-147459990 AGATTTCAACACATGAATCTTGG - Intergenic
1017043810 6:150328797-150328819 ATATATACACACAAACATATTGG + Intergenic
1017119697 6:151012704-151012726 ATATATACACACATCCTTATTGG - Intronic
1017366780 6:153651642-153651664 ATATACACATACATTAATGTAGG + Intergenic
1017533056 6:155315913-155315935 ATATATAGAAATACGAATCTAGG + Intergenic
1017750203 6:157484476-157484498 ATATATACACACACAAATAGAGG + Intronic
1017967996 6:159283553-159283575 ATATATACATATATGTATATAGG - Intergenic
1017967997 6:159283579-159283601 ATATATACATATATGTATATAGG - Intergenic
1017967998 6:159283605-159283627 ATATATACATATATGTATATAGG - Intergenic
1018323642 6:162640016-162640038 TTATATATACCCATAAATCTGGG + Intronic
1019032900 6:169028334-169028356 ATAAATACTCACATGAGTTTAGG + Intergenic
1020157614 7:5739507-5739529 CTATGTAGACAGATGAATCTGGG - Intronic
1020417371 7:7961339-7961361 GAATATACAAATATGAATCTTGG + Intronic
1021126887 7:16861380-16861402 ATACCTACAAACATGATTCTAGG + Exonic
1021345489 7:19522310-19522332 ATATATACACACATATATATAGG - Intergenic
1021744946 7:23730722-23730744 ATTGAAACACACATGAATCAAGG + Intronic
1023324555 7:39039005-39039027 ATATATAAATACATGGATTTAGG + Intronic
1023459822 7:40384107-40384129 ATATATTGACACATGATTGTGGG + Intronic
1024111640 7:46153163-46153185 ACTGATACACACATGAATGTGGG - Intergenic
1024173893 7:46818773-46818795 ATATATATAAACATCAATCATGG + Intergenic
1024366523 7:48526968-48526990 ATATATACAAAAATGAAATTGGG - Intronic
1024560693 7:50642500-50642522 ATATATATACACATACATATAGG + Intronic
1025264603 7:57445845-57445867 ATATATATACACATATATATAGG + Intergenic
1025474114 7:60898658-60898680 ATAAAGACACATATGATTCTTGG + Intergenic
1025480286 7:60974818-60974840 ATATAGACACATATGATTCTTGG + Intergenic
1025512888 7:61591216-61591238 ATAAAGACACATATGATTCTTGG - Intergenic
1025551688 7:62257535-62257557 ATAAAGACACATATGATTCTTGG - Intergenic
1025765182 7:64439516-64439538 ATATATACATATATGAAGATTGG + Intergenic
1026191726 7:68135006-68135028 ATATATACACACATAGTACTTGG - Intergenic
1026427855 7:70314457-70314479 ACCTATGCACACATCAATCTGGG - Intronic
1026631735 7:72043801-72043823 ATAAAGACACACATGAGACTGGG + Intronic
1026727900 7:72884732-72884754 ATATATACACACACGTATATAGG - Intronic
1027115940 7:75481055-75481077 ATATATACACATACGTATATAGG + Intronic
1027515192 7:79133555-79133577 ATATATAAATACATGTTTCTAGG - Intronic
1027934079 7:84580127-84580149 ATATATTCCCACATAAATTTGGG - Intergenic
1028181923 7:87734284-87734306 ATATAGACACACATGCACCTAGG - Intronic
1028239519 7:88402599-88402621 GTATATACATACATGTATGTAGG + Intergenic
1028915513 7:96254569-96254591 ATATATACACACACATATGTGGG - Intronic
1029290272 7:99497047-99497069 ATATATACACATATATATATAGG - Intronic
1030431899 7:109458861-109458883 ATATATACATATATAAATGTAGG - Intergenic
1030503674 7:110392067-110392089 ATATATACACACACACATATGGG - Intergenic
1030654934 7:112157073-112157095 ATACATACTCACAGAAATCTAGG - Intronic
1030763296 7:113378015-113378037 ATATATATACACATATATATAGG + Intergenic
1030820803 7:114088024-114088046 ACAAATACACACATGGGTCTAGG - Intronic
1031091243 7:117357479-117357501 AAACATACACACATTAGTCTAGG - Intergenic
1031150029 7:118042967-118042989 ATCTATTCAGACATGCATCTGGG + Intergenic
1031536467 7:122939715-122939737 ATATATACACACACACATATAGG + Intergenic
1031630209 7:124034501-124034523 ATCTATCCGCACATGAATTTCGG - Intergenic
1031712799 7:125070193-125070215 ACACACACACACATGAATTTAGG + Intergenic
1031780615 7:125958097-125958119 ATATATACACATATATATATAGG - Intergenic
1032065943 7:128770792-128770814 ATATATACATATATTTATCTTGG - Exonic
1032246078 7:130214100-130214122 ATATGTACACACAGGAGTTTTGG - Intronic
1032948308 7:136877304-136877326 ATCTAAACACACAGGTATCTAGG - Intronic
1033655459 7:143370712-143370734 AAATACACACACATGAAAATGGG + Intergenic
1033876559 7:145826481-145826503 ATATATACATACATATATATAGG + Intergenic
1034015182 7:147575453-147575475 ATATATACACCCCTAAAGCTAGG - Intronic
1034130696 7:148714013-148714035 AAATATACACACATGCAGCCAGG - Intronic
1034286636 7:149888009-149888031 ATAAAGACACACCTGAAACTGGG - Intergenic
1035941016 8:3901092-3901114 AAGTATACACACATTAACCTTGG - Intronic
1036192863 8:6687050-6687072 ATATATACACATATATATCTGGG - Intergenic
1037140459 8:15512880-15512902 ATATATACACACAATTCTCTCGG + Intronic
1037201477 8:16258450-16258472 ATATATACACACATATATGTTGG + Intronic
1037204604 8:16300585-16300607 ATATACACACACATGAATAAAGG + Intronic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1037701606 8:21280354-21280376 ATATTTACAAACATGAAACTAGG - Intergenic
1039137823 8:34346436-34346458 GTATACACACACATGCATGTGGG + Intergenic
1039605815 8:38879585-38879607 ATATATACACATATATATATGGG + Intergenic
1040353948 8:46597366-46597388 ATATATACACTAAATAATCTTGG + Intergenic
1040395713 8:46998299-46998321 ATATATACATATATGGATATAGG - Intergenic
1041434554 8:57823865-57823887 ATATATACATACATTCATCTTGG - Intergenic
1042296241 8:67221423-67221445 ATAGACACACACATTAACCTAGG - Intronic
1042429087 8:68683560-68683582 ATATATACACATTTGAAACATGG + Intronic
1042493032 8:69423210-69423232 ATATATACACACATGTAGAGGGG - Intergenic
1042747776 8:72126110-72126132 ATATATACTCACAGTAAACTAGG - Intergenic
1043040258 8:75253771-75253793 ATAAAGACACACATGAAACTGGG + Intergenic
1043068432 8:75606902-75606924 ATACATCCACACATGAATGTGGG - Intergenic
1043084183 8:75807336-75807358 ATATTTAGACATATGATTCTTGG - Intergenic
1043317954 8:78944584-78944606 ATTTATACACACATAAATCTGGG - Intergenic
1043491870 8:80757282-80757304 ATAAATACACACATTAGCCTGGG - Intronic
1043666718 8:82824818-82824840 ATATATATATATATGAATCCAGG + Intergenic
1044216861 8:89622591-89622613 ATATATACACACATGCACACAGG - Intergenic
1044314912 8:90738912-90738934 AGATATAGGCACATCAATCTTGG - Intronic
1045817014 8:106288501-106288523 ATATATACACACACATATTTAGG - Intronic
1046091485 8:109508075-109508097 ATATATATACATATGTTTCTAGG + Exonic
1047136633 8:122086103-122086125 ACAAAAACACACATTAATCTAGG - Intergenic
1047466706 8:125123249-125123271 TTATAAACACACCTGAGTCTAGG - Intronic
1048607569 8:135985485-135985507 ATATATACACAAATATATATAGG - Intergenic
1048722769 8:137345389-137345411 ATATATACACACACATATATAGG - Intergenic
1049996427 9:1039106-1039128 TTATTAACACACAGGAATCTAGG + Intergenic
1050016197 9:1236846-1236868 ATAAATACACACCTGAGACTGGG + Intergenic
1050622562 9:7469744-7469766 AGATCTACTCACATGAATCGTGG + Intergenic
1050842163 9:10164734-10164756 ATATATACACACATACATCCAGG + Intronic
1050970506 9:11865898-11865920 ATATATATACACACAAATTTTGG - Intergenic
1051111434 9:13641924-13641946 ATATATACACACATATATAATGG + Intergenic
1051561792 9:18450552-18450574 ATATATGTATATATGAATCTGGG - Intergenic
1051865912 9:21682359-21682381 ATACATACACACATGAACACAGG + Intergenic
1051957904 9:22718792-22718814 ACATATATATACATCAATCTTGG - Intergenic
1051975258 9:22941237-22941259 ATAAAGACACACCTGAAACTGGG + Intergenic
1052197638 9:25736838-25736860 ATATATACACATATGCATGCAGG - Intergenic
1052369003 9:27643611-27643633 ATATATACACATATGTATATGGG - Intergenic
1052527395 9:29636423-29636445 ATCTATAAACACATGAAACTCGG + Intergenic
1052686289 9:31761625-31761647 GTATATATACACATTAATATTGG - Intergenic
1052792810 9:32891850-32891872 AATTATACATACATGAAGCTTGG - Intergenic
1052926366 9:34020179-34020201 ATAAACACACACATTAGTCTAGG + Intronic
1053327210 9:37164859-37164881 ATCTATACAGAAATGCATCTGGG - Intronic
1053646846 9:40126239-40126261 ATATACACACATATGTATATAGG - Intergenic
1053646847 9:40126266-40126288 ATATACACACATATGTATATAGG - Intergenic
1053646848 9:40126293-40126315 ATATACACACATATGTATATAGG - Intergenic
1053646849 9:40126320-40126342 ATATACACACATATGTATATAGG - Intergenic
1053646850 9:40126347-40126369 ATATACACACATATGTATATAGG - Intergenic
1053646851 9:40126374-40126396 ATATACACACATATGTATATAGG - Intergenic
1053646852 9:40126401-40126423 ATATACACACATATGTATATAGG - Intergenic
1053646853 9:40126428-40126450 ATATACACACATATGTATATAGG - Intergenic
1053646854 9:40126455-40126477 ATATACACACATATGTATATAGG - Intergenic
1053646855 9:40126482-40126504 ATATACACACATATGTATATAGG - Intergenic
1053944966 9:43297729-43297751 ATAAAGACACATATGATTCTTGG - Intergenic
1054703650 9:68439500-68439522 ATATATACACTCATATATATGGG - Intronic
1056041569 9:82673026-82673048 AAAAACACACACATGAGTCTAGG - Intergenic
1056575713 9:87855015-87855037 ATATATACACACATGAGCAGAGG + Intergenic
1057333308 9:94136876-94136898 ATAAATAAACACATGAAAATAGG + Intergenic
1057572225 9:96213354-96213376 ATATATGCAGACATGAAGCCAGG + Intergenic
1057753745 9:97812863-97812885 ATATGTACACACATATATATAGG + Intergenic
1058129759 9:101238106-101238128 ATATATACACACACGTATATAGG - Intronic
1058224950 9:102348535-102348557 ATATAAGCATACATGAGTCTGGG - Intergenic
1058245448 9:102618483-102618505 ATATACACACACACGCATATAGG - Intergenic
1060436130 9:123594795-123594817 ATATATATGCACATGCATTTGGG - Intronic
1062195930 9:135274095-135274117 ATATATACACCCATGAATAAAGG + Intergenic
1202794639 9_KI270719v1_random:110118-110140 ATATATATACACATATATATTGG + Intergenic
1203588101 Un_KI270747v1:26307-26329 ATAAAGACACATATGATTCTTGG - Intergenic
1203615232 Un_KI270749v1:56410-56432 ATAAAGACACATATGATTCTTGG + Intergenic
1185700994 X:2230005-2230027 ATATGTGCACACATGCATGTGGG + Intronic
1186310732 X:8315709-8315731 ATATATACACACATATATATAGG - Intergenic
1186980616 X:14954235-14954257 ATAAAGACACACCTGAACCTGGG + Intergenic
1188063727 X:25631828-25631850 ATATATACACATATGTTTGTTGG + Intergenic
1188220657 X:27537694-27537716 GTATTTCCACACATGCATCTGGG + Intergenic
1188341431 X:29006622-29006644 ATATAAACACACACAAATGTGGG - Intronic
1188698833 X:33233784-33233806 ATATACACACACATGAGTATAGG + Intronic
1188728895 X:33621389-33621411 ACACATACACACATGGATATGGG + Intergenic
1188814696 X:34698092-34698114 ATATACATACATATGCATCTAGG - Intergenic
1188855925 X:35195816-35195838 ATAAACACACACATTAACCTAGG - Intergenic
1188917033 X:35924583-35924605 ATATATACACACGTGCATGTGGG + Intronic
1190080330 X:47352084-47352106 ATATATACACACACAATTTTTGG - Intergenic
1191673262 X:63768910-63768932 ATACATACATACCTGAAACTGGG - Intronic
1191745960 X:64486931-64486953 ATATATACCCAAAGGAATATAGG - Intergenic
1191803483 X:65107006-65107028 ATGGATACTCACATGAATGTAGG + Intergenic
1192899674 X:75482946-75482968 ATATATACACTTATGATTATCGG - Intronic
1193370208 X:80687085-80687107 ATATATACACACATACAGATAGG - Intronic
1193503044 X:82304038-82304060 ATATATACACACATACACATTGG + Intergenic
1193611590 X:83638235-83638257 ACAGACACACACATGAACCTAGG + Intergenic
1193875795 X:86861380-86861402 ATTTATACATACAGAAATCTGGG + Intergenic
1194000294 X:88420335-88420357 ATAAAGACATACATGAAACTGGG - Intergenic
1194159271 X:90431212-90431234 AAACATACACACATACATCTTGG + Intergenic
1194264426 X:91737679-91737701 ATAAAGACATACATGAAACTGGG - Intergenic
1194369171 X:93049276-93049298 ACATTTACAAACATAAATCTTGG + Intergenic
1194533982 X:95083715-95083737 ATACATACACACAAGCATCTTGG + Intergenic
1194614293 X:96082516-96082538 ATATATACACACATTGAGATAGG - Intergenic
1194860068 X:98987535-98987557 ATATATATACACATGATCCATGG + Intergenic
1195171870 X:102276985-102277007 CTACATACACACATCAATCAAGG - Intergenic
1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG + Intronic
1195550737 X:106167079-106167101 AAATAAACAGACATTAATCTGGG + Intergenic
1195628458 X:107029037-107029059 ACACACACACACATGAAACTAGG + Intergenic
1196622565 X:117840199-117840221 ATATACATACACATGAACCTGGG + Intergenic
1197153332 X:123243993-123244015 ATATATGAACACATGTATTTTGG - Intronic
1197418815 X:126210671-126210693 ATATATATACACATATATATCGG + Intergenic
1197459715 X:126725113-126725135 ATATATACACACACACATTTAGG - Intergenic
1197618058 X:128716221-128716243 ATATATGCACACATATAACTAGG - Intergenic
1197621619 X:128756776-128756798 ATATATACACACCTATATATCGG + Intergenic
1197691879 X:129510004-129510026 ATATAGACAGATTTGAATCTTGG - Intronic
1198077415 X:133207165-133207187 AGAGATACACACAGGTATCTGGG - Intergenic
1198202633 X:134437056-134437078 ATATGTACACAAATGCATTTTGG - Intergenic
1198305790 X:135381739-135381761 GTTTGTACACCCATGAATCTAGG - Intergenic
1198559386 X:137832263-137832285 ATATATACACACACACATCATGG - Intergenic
1198597057 X:138247987-138248009 ATATATAGACACATCATTCATGG - Intergenic
1198724056 X:139658090-139658112 ATCTATATACTCATGAATTTGGG + Intronic
1198790955 X:140345388-140345410 ATATATACACATATATATATGGG + Intergenic
1198919473 X:141709221-141709243 ATAAAGACATACCTGAATCTGGG + Intergenic
1199068937 X:143453346-143453368 ATATATACATACATACATCTTGG - Intergenic
1199112304 X:143949345-143949367 ATATATATACACCTGAGACTGGG + Intergenic
1199800269 X:151243806-151243828 ATATATATACATATGAAGCTAGG - Intergenic
1199965885 X:152820573-152820595 ATATATACATATATGAATACTGG - Intergenic
1200469448 Y:3564876-3564898 ATATATACACACCTATATATGGG + Intergenic
1200505575 Y:4008181-4008203 AAACATACACACATACATCTTGG + Intergenic
1201052519 Y:9951738-9951760 ATATACACACATATGTATGTTGG + Intergenic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic
1201503100 Y:14667431-14667453 ATACATACACACATAAATACAGG + Intronic
1201650992 Y:16286005-16286027 ATATATACACACATATATCCTGG - Intergenic
1202188097 Y:22209522-22209544 ATATACACACACATATATGTTGG + Intergenic