ID: 1141044343

View in Genome Browser
Species Human (GRCh38)
Location 16:80703113-80703135
Sequence GTGTATGTGCATATTCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141044343_1141044347 3 Left 1141044343 16:80703113-80703135 CCATGTAGAATATGCACATACAC 0: 1
1: 1
2: 1
3: 20
4: 200
Right 1141044347 16:80703139-80703161 CACCTGGGCAAAAAGAGAGGTGG 0: 1
1: 1
2: 2
3: 40
4: 333
1141044343_1141044346 0 Left 1141044343 16:80703113-80703135 CCATGTAGAATATGCACATACAC 0: 1
1: 1
2: 1
3: 20
4: 200
Right 1141044346 16:80703136-80703158 ACACACCTGGGCAAAAAGAGAGG 0: 1
1: 0
2: 1
3: 38
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141044343 Original CRISPR GTGTATGTGCATATTCTACA TGG (reversed) Intronic
906153536 1:43601285-43601307 GTGCATGTAGATATTCTAGATGG - Intronic
908461038 1:64348485-64348507 GGGTATGAGCATATTCAGCAGGG + Intergenic
910021822 1:82600229-82600251 GTTTATATTCATTTTCTACATGG - Intergenic
910894354 1:92052232-92052254 GTGCCTATTCATATTCTACAAGG - Intronic
912145767 1:106792291-106792313 GTGTATGTTCACATTTTAAAAGG + Intergenic
912215264 1:107603503-107603525 GTGTCTGTGTATCTTATACAGGG - Intronic
917415715 1:174807304-174807326 ATGTATGTGTATTGTCTACATGG - Intronic
918219380 1:182422248-182422270 GTGTATGTAGATATTGTAAATGG + Intergenic
922980621 1:229823461-229823483 GTGTATGCCCAGATTCCACAAGG + Intergenic
924488682 1:244513483-244513505 GTGTATATGCATGTTGTCCAGGG - Intronic
1065404101 10:25343796-25343818 GTGTGTGTGCATTTTCTAGCAGG - Intronic
1065960303 10:30728485-30728507 GTGTATGTGTATATTTTCCCTGG - Intergenic
1068906606 10:62332895-62332917 GTGTATGTTCATATGCTTGATGG + Intergenic
1069584825 10:69592192-69592214 GTCTATATCCTTATTCTACAAGG - Intergenic
1073091214 10:100941191-100941213 GTGTATATGCATATTCATCATGG + Intronic
1075806095 10:125189855-125189877 GTGTGTGTGTATAGTGTACATGG + Intergenic
1075821085 10:125312003-125312025 GTGTGTGTGTATATTGTAAATGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078222397 11:9362760-9362782 GTGTTTGTGAAGATTCTATAAGG - Intergenic
1079713356 11:23714169-23714191 GTGTGTGTGTATATTTTAAAAGG + Intergenic
1080789147 11:35505144-35505166 ATGTATTTGCATATTTTCCAAGG + Intronic
1080929713 11:36797006-36797028 GTGTATGTGTATATTTTGGAGGG + Intergenic
1082979797 11:59108926-59108948 TAGTATGTTCATATTTTACATGG + Intronic
1083116695 11:60467090-60467112 GTGGATGTGGATTTTCTAGAGGG - Intronic
1084079161 11:66808092-66808114 GTGTGTGTGCATATGCACCATGG - Intronic
1085694908 11:78695867-78695889 GTGTATGTACTTATTCTGCTTGG + Intronic
1086170940 11:83835915-83835937 GTGTATGTGTATATACCATAGGG - Intronic
1086170943 11:83835944-83835966 ATGTATGTGTATATACTATAGGG - Intronic
1087111108 11:94468718-94468740 TTCTATGTGCATATTCAATATGG + Intronic
1087437583 11:98141938-98141960 GTGTATGTGAATATTCTGTGTGG - Intergenic
1088491334 11:110390961-110390983 GTGTATGTGTGTATTTTTCAGGG - Intergenic
1088880513 11:113970043-113970065 GTGTATTGCCATCTTCTACATGG - Intergenic
1094136115 12:27128384-27128406 GTGTCTGTGAATATTTTCCATGG - Intergenic
1097744835 12:63289934-63289956 GTGTCTGTTCATATTTTAAAAGG + Intergenic
1099806482 12:87526873-87526895 GTGTCTGTTCATATCCTAAAAGG - Intergenic
1100272579 12:93040487-93040509 GTGTATGTGCATATAACATAAGG + Intergenic
1100677911 12:96888074-96888096 GCATATGTGCAGATTCTACATGG + Intergenic
1104677925 12:130727695-130727717 TTGTATTTGCATATTAGACAAGG + Intergenic
1106497435 13:30293362-30293384 GTGTATGTGCACAGTGTAAAAGG - Intronic
1107884181 13:44860722-44860744 GTTTATGTGCATAGTCTAGTTGG - Intergenic
1107952079 13:45472307-45472329 GTGTATGTGTGTATTCTGCTTGG + Intronic
1109236327 13:59825844-59825866 GTGTCTGTTCATATCCTTCAAGG + Intronic
1109296768 13:60542434-60542456 GTGTGTGTGTGTATTCAACAAGG - Intronic
1109358232 13:61261117-61261139 GTGAATGTGCTTATTTTTCATGG + Intergenic
1109423203 13:62140066-62140088 ATGTATGAGCATATTTTCCATGG + Intergenic
1110504087 13:76264325-76264347 GTGTATGTGGTTATTATAGATGG - Intergenic
1112550854 13:100419041-100419063 GTGTGTGGGAATATTCTAGAAGG - Intronic
1112899216 13:104338804-104338826 GTGCATGTGCATAGTGTGCATGG - Intergenic
1113091490 13:106621255-106621277 GTGCATTTGCTTATTCTCCAGGG + Intergenic
1116362358 14:44015810-44015832 GTGTTTGTGCAAATTTTAGAGGG + Intergenic
1117245758 14:53885129-53885151 CTGTATGTGCATGTTTTACTTGG - Intergenic
1117533368 14:56680587-56680609 GGGAATGTGCCCATTCTACAGGG - Intronic
1119095052 14:71822354-71822376 GTGTATGTATATATGCTAAAAGG - Intergenic
1202846994 14_GL000009v2_random:187049-187071 GTGTACGTATAAATTCTACATGG + Intergenic
1202876327 14_KI270722v1_random:5460-5482 GTGTACGTATAAATTCTACATGG - Intergenic
1202891146 14_KI270722v1_random:159175-159197 GTCTATGTGGATATGTTACATGG + Intergenic
1123496961 15:20836374-20836396 GTGTGTGTGTGTATTCTAGATGG - Intronic
1123554194 15:21409966-21409988 GTGTGTGTGTGTATTCTAGATGG - Intronic
1123590440 15:21847331-21847353 GTGTGTGTGTGTATTCTAGATGG - Intergenic
1131419214 15:92289906-92289928 TTTTATTTGCATAGTCTACACGG - Intergenic
1202962541 15_KI270727v1_random:137162-137184 GTGTGTGTGTGTATTCTAGATGG - Intergenic
1132467954 16:86295-86317 GTGTTTCTGCACATTCTTCAGGG + Exonic
1133253994 16:4505098-4505120 GTGCATGTGCATATGCTGCAGGG - Intronic
1135475930 16:22774851-22774873 GTGTATGTCCATATTTTTTATGG - Intergenic
1138809767 16:60135367-60135389 GTGTATGTGGCTATTATAAACGG + Intergenic
1138817611 16:60221081-60221103 GTGTTTGTGTATCATCTACAGGG - Intergenic
1138985793 16:62327275-62327297 GTATATGTGTATATTCTCTAGGG + Intergenic
1140264816 16:73411346-73411368 GTTTATGTGCATATTTCAAAGGG - Intergenic
1140746644 16:77986462-77986484 GTGTTTGTGAATATGCTGCATGG - Intergenic
1141044343 16:80703113-80703135 GTGTATGTGCATATTCTACATGG - Intronic
1141211369 16:81983305-81983327 GTGTGTGTGGCTATTCTAAATGG - Intergenic
1143954205 17:10656148-10656170 GTGTATGTGCATATTCTTCCAGG - Exonic
1145303863 17:21659727-21659749 GTGTGTGTGTATATTCGAGATGG + Intergenic
1145346170 17:22042094-22042116 GTGTGTGTGTATATTCGAGATGG - Intergenic
1146427152 17:32751660-32751682 GTGTTTGTGGATATTGTAAATGG - Intronic
1149962295 17:61124006-61124028 TTTTATGTGCTTATACTACATGG + Intronic
1154261269 18:12834986-12835008 TTGTATCTGCAGGTTCTACAGGG - Intronic
1154454978 18:14512764-14512786 GTGTGTGTGTGTATTCTAGATGG - Intronic
1155517795 18:26640554-26640576 GTGTATGTGCAGATGCATCATGG - Intronic
1156421476 18:36958246-36958268 TTGTATATACATATTCAACATGG - Intronic
1156486303 18:37468049-37468071 ACGTGTGTGCATATTCTACATGG + Intronic
1159136871 18:64346993-64347015 GTATATGTGCATATTGTATATGG + Intergenic
1159272571 18:66171239-66171261 GTGTGTGAGCACATCCTACATGG + Intergenic
1159500300 18:69260226-69260248 GTATATTTGCAGATTCTACATGG - Intergenic
1159519945 18:69506862-69506884 GTGTGTGTGCATTTTCAACAAGG - Intronic
1159825928 18:73210260-73210282 GTGAATATCCATAATCTACAAGG + Intronic
1160604643 18:80040623-80040645 ATGTATTTGCAAATTCTCCAAGG - Intronic
1163970791 19:20792491-20792513 GTGTGTGTGTATATTTTTCAGGG + Exonic
1164607955 19:29613506-29613528 GTGTTTGTGCAGATCCTGCAAGG + Intronic
1202666567 1_KI270708v1_random:126013-126035 GTCTATGTGGATATGTTACATGG + Intergenic
929060201 2:37915884-37915906 GTGTAAATGCTTATTCTACCTGG + Intergenic
931012833 2:57937522-57937544 GTGTAAGTGCATTATTTACATGG + Intronic
931503590 2:62898939-62898961 GTGTAGGTGCATATTCTACATGG - Intronic
935134503 2:100288075-100288097 GTGTATGCGCTTATTTTAAATGG - Intronic
935642589 2:105305375-105305397 GTGTATGTGTTTATGGTACAGGG - Intronic
935895358 2:107731242-107731264 GTGTATTTTCATATTGTCCAAGG - Intergenic
939239849 2:139543552-139543574 AACTATGTGCATATTCCACAAGG - Intergenic
939693492 2:145294963-145294985 GTGTATATACATATTATATAAGG + Intergenic
943892791 2:193311656-193311678 GTGTTTTTACATATTCTAAAAGG - Intergenic
945642617 2:212447796-212447818 GTGTGTGTGTGTATTCAACATGG + Intronic
945977076 2:216279372-216279394 AAGTCTCTGCATATTCTACAAGG - Intronic
948310192 2:236979727-236979749 GTATATGTGTCTAGTCTACATGG - Intergenic
1169361187 20:4950665-4950687 AGGTATTTGCATATTCCACAGGG - Intronic
1173000246 20:39100387-39100409 AGGTATGTGCATAGTATACATGG - Intergenic
1173163212 20:40667727-40667749 GTGTATGTGGATTGTATACATGG + Intergenic
1173890481 20:46505187-46505209 GTGTCTGTGTATATTCTTAATGG - Intronic
1175240677 20:57545999-57546021 GTGAATGTGCATCTCCCACAAGG + Intergenic
1176635807 21:9192295-9192317 GTGTACGTATAAATTCTACATGG + Intergenic
1176637593 21:9262832-9262854 ATGTATGTATAAATTCTACATGG - Intergenic
1177342198 21:19817930-19817952 GTGTTTATGCATTTTCTTCATGG + Intergenic
1177608221 21:23409247-23409269 TTTTATGTGCAAATTCTAAAGGG - Intergenic
1177663734 21:24123973-24123995 GTGGATGTGCATTTTCCAAAAGG - Intergenic
1179586033 21:42374680-42374702 GTGAATGTGCTGATGCTACAGGG + Intronic
1180371373 22:12040578-12040600 GTGTATGTATAAATTCTACATGG + Intergenic
1180414315 22:12694164-12694186 GTGTACGTATAAATTCTACAAGG - Intergenic
1180421633 22:12870329-12870351 ATGTATGTATAAATTCTACATGG - Intergenic
1184461978 22:44643457-44643479 GTTCATGTTCATTTTCTACATGG - Intergenic
951715752 3:25644351-25644373 GTATATGTACAAATTCTGCAAGG + Intronic
953449838 3:42996893-42996915 GAGTTTGTGCACATTCTCCAAGG - Intronic
955531867 3:59881518-59881540 GTGTATGTGCATTTTCCTCAGGG - Intronic
955897324 3:63714307-63714329 TTGTATGTGCAGTTTCTACAGGG + Intergenic
956621902 3:71229652-71229674 GCCCATTTGCATATTCTACAAGG - Intronic
957681842 3:83446601-83446623 GAGAATGAGCCTATTCTACAGGG - Intergenic
957757795 3:84512767-84512789 GTGTGTGTGCCTATTGTAAATGG + Intergenic
959228229 3:103614217-103614239 ATGTGTGTGCATCTTTTACATGG - Intergenic
960093351 3:113664656-113664678 GTGTGTGTGTGTATTCTTCAAGG - Intronic
960169713 3:114444915-114444937 ATGTATTTTCAAATTCTACATGG + Intronic
962056460 3:131876856-131876878 GTGCTGGTGCATCTTCTACATGG - Intronic
966399109 3:179529999-179530021 GAGTATGTGCCTCTTCTCCAGGG - Intergenic
966959861 3:184924694-184924716 GTGGTTGTGCTTATTCTAAATGG + Intronic
1202749302 3_GL000221v1_random:142189-142211 ATGTATGTATAAATTCTACATGG + Intergenic
968401178 4:299095-299117 TTTTATGTGCATATTCTAGGTGG + Intronic
969283928 4:6190735-6190757 GTGTGTGTGCTTGTTCCACATGG - Intronic
970557634 4:17250821-17250843 TTTTATGTGCATAGTCTTCATGG - Intergenic
972026929 4:34392488-34392510 GTATATGAGAATATTATACAAGG - Intergenic
972103822 4:35457370-35457392 GTGTCTGGGCATTTTCTGCAAGG + Intergenic
972197497 4:36671821-36671843 GTGTGTGGGCAAAATCTACATGG - Intergenic
974423815 4:61714208-61714230 GTGTGTGTGCGTATTTTACATGG - Intronic
974582616 4:63824507-63824529 GTGTGTGTGTATAATCTATATGG - Intergenic
974622950 4:64384828-64384850 GTGTCTGTGCACATTATCCAGGG - Intronic
974639219 4:64607674-64607696 GTGTATTGGCTTATACTACAAGG + Intergenic
974739078 4:65980928-65980950 GTGTGTGTGCCTATTGTAAACGG + Intergenic
975127148 4:70795581-70795603 CTGTGTGTACATATTATACAAGG + Intronic
976347025 4:84015863-84015885 GTTTATGTGAATATTCTATGTGG - Intergenic
978833214 4:113114813-113114835 GTGTATCAGCAGATTCTAAAGGG + Intronic
983810911 4:172061037-172061059 ATGTATGTGTATTTTCTTCATGG - Intronic
984314529 4:178110312-178110334 GTGTTTGTGCAGAGTCAACATGG + Intergenic
1202752491 4_GL000008v2_random:21248-21270 GTGTACGTATAAATTCTACATGG - Intergenic
986120711 5:4833510-4833532 ACGTATGTGCATATTTTTCATGG + Intergenic
987965443 5:24866049-24866071 GCGTATCTGGATTTTCTACAGGG - Intergenic
988398025 5:30721577-30721599 GTATATTTTCATAATCTACAAGG + Intergenic
989695274 5:44192677-44192699 GTGTATGGCCATATTGTACAAGG + Intergenic
990809797 5:59710076-59710098 GTGCATCTGAATATGCTACAAGG + Intronic
993047254 5:82881353-82881375 GTGTCTGTGCATGTTGTCCAGGG - Intergenic
994173701 5:96686653-96686675 GAGTATGTGGAGATTCTGCATGG + Intronic
994307793 5:98227584-98227606 GTGTCTGTGCATACTGCACAGGG + Intergenic
994561041 5:101372786-101372808 GTGTTTGTGCATATTCAATATGG - Intergenic
995377898 5:111498144-111498166 ATGTATGTGCAGCTTCTAGATGG - Exonic
996111974 5:119576645-119576667 GTGTGTGTTTATGTTCTACAAGG - Intronic
997349382 5:133219612-133219634 GTGTTTGAGCATTTTCTAGATGG + Intronic
997798843 5:136839629-136839651 GTGCTTGTTCATATTCTTCATGG + Intergenic
999529516 5:152446952-152446974 GTCTATATGCATAATCTACAAGG + Intergenic
1003819045 6:9875094-9875116 GGATTTGTGCAAATTCTACATGG + Intronic
1008697552 6:54058122-54058144 GTGTATGTGTATATTTTAGGGGG + Intronic
1008804487 6:55411197-55411219 GTATATGTGAATTTTCTACTAGG + Intergenic
1012093192 6:94926059-94926081 GTGTCTTTTCCTATTCTACAAGG + Intergenic
1012385848 6:98681469-98681491 GTGTATGTGGATAGTGTACATGG + Intergenic
1012544407 6:100401167-100401189 GTTTGTGTGCTTATTCTTCATGG - Intronic
1014037775 6:116787708-116787730 GTGTATCTGGATTTTGTACAAGG - Intergenic
1015617157 6:135089474-135089496 GTGAAAGTGAATATTCTCCATGG + Intronic
1018516473 6:164585103-164585125 TTGTATGTGCATTTACTACCTGG - Intergenic
1020758506 7:12237798-12237820 GTGTATGTATATATTTTATATGG - Exonic
1021435115 7:20605078-20605100 GTGTCTGTTCATATCCTTCATGG + Intergenic
1022544383 7:31172365-31172387 GAGTATGTGGATATTATGCAAGG - Intergenic
1022547341 7:31201359-31201381 GTGTGTGTGCATTTTCCAGATGG - Intergenic
1025240900 7:57272518-57272540 GTGTATCTGCATTTTCTTTATGG + Intergenic
1025706754 7:63873401-63873423 GTGTATCTGCATTTTCTTTATGG + Intergenic
1026041420 7:66871319-66871341 GTGGATGTACATATTGTCCATGG + Intergenic
1027716906 7:81683687-81683709 GTGTGTGTGCATATACCATAGGG + Intergenic
1033179023 7:139156618-139156640 ATTTAAGTCCATATTCTACATGG + Intronic
1033329128 7:140403694-140403716 GTACATGTGCATATTGTACTGGG - Intronic
1033534033 7:142295776-142295798 GTGTGTGTGAATATTCTAGATGG - Intergenic
1033815304 7:145063743-145063765 GAAGATGTGCATATTCTTCATGG + Intergenic
1034048038 7:147950570-147950592 GTGTTTGTGCAGCTTCCACAGGG - Intronic
1038305004 8:26392302-26392324 GTGCATTTGCATTTTCTAAATGG - Intronic
1038617532 8:29108925-29108947 ATTTATGTGCATATTGAACATGG - Intronic
1039417081 8:37404643-37404665 TTGTATGTGCATACCTTACAGGG - Intergenic
1040359024 8:46647270-46647292 GTGTTTGGGCATCTTATACATGG + Intergenic
1040382147 8:46883348-46883370 GTGTTTGGGCATCTTATACATGG - Intergenic
1040615693 8:49035827-49035849 GTGTGTGTGTGTATTATACATGG - Intergenic
1041707542 8:60862453-60862475 GTGTATGTGTGTATTATAGAAGG + Intronic
1041853013 8:62415636-62415658 ATGTGTATGCATATCCTACAAGG + Intronic
1042050036 8:64693740-64693762 GTGTATGTGTATATATTGCATGG - Intronic
1042417767 8:68544123-68544145 GGGTATGGACATAGTCTACAGGG + Intronic
1042784476 8:72533082-72533104 GTATGTGTGTATATTCTAGAAGG - Intergenic
1043199257 8:77342734-77342756 GTGTATGTACATATTTTCCATGG + Intergenic
1044518803 8:93173836-93173858 GTGTGTGTGCATGTGCTATAAGG + Intergenic
1044564455 8:93648132-93648154 GTGCATGTGAATATTCTCCCTGG + Intergenic
1045895707 8:107213878-107213900 GTGTGTGTGCGTATTTTATAGGG + Intergenic
1047136249 8:122081833-122081855 GTCTATGTGGAGAGTCTACATGG + Intergenic
1051163217 9:14232222-14232244 GTGTTTGTGCCTTTTCTGCATGG + Intronic
1051394740 9:16607653-16607675 ATGTATTTGTATATGCTACACGG + Intronic
1052356118 9:27506469-27506491 GTATATGTTCATATTCTGTATGG + Intronic
1057483640 9:95464848-95464870 GTGTTTGAACATTTTCTACAAGG - Intronic
1058864513 9:109149315-109149337 GTGTCTGTGCTTATTCAGCAGGG - Intronic
1061799848 9:133107759-133107781 GTGACTGTGCAGATTCTAGATGG - Intronic
1203528172 Un_GL000213v1:109018-109040 GTGTGTGTGTGTATTCTAGATGG - Intergenic
1203758583 Un_GL000218v1:159603-159625 GTGTATGTATAAATTCTACATGG + Intergenic
1203717941 Un_KI270742v1:172279-172301 ATGTATGTATAAATTCTACATGG + Intergenic
1203533279 Un_KI270743v1:5950-5972 GTGTACGTATAAATTCTACATGG - Intergenic
1203652162 Un_KI270751v1:135868-135890 GTGTATGTATAAATTCTACATGG + Intergenic
1186007321 X:5087322-5087344 GTGTGAGTGCATATACTGCAGGG + Intergenic
1186154887 X:6715009-6715031 GTGTGTGTACATATTTTATAAGG + Intergenic
1190411695 X:50142906-50142928 ATGTATATGCATAGACTACAAGG + Intergenic
1192619183 X:72659874-72659896 GTGTATTTACATATTGTCCATGG - Intronic
1192742722 X:73909055-73909077 GTGTGTGTGCCTATTGTAAATGG + Intergenic
1192929198 X:75786932-75786954 ATGAATGTGCATGTTCTAGACGG + Intergenic
1195863481 X:109406100-109406122 GTATATGTGCATTTTTTACAGGG - Intronic
1196044144 X:111238974-111238996 GTGTATGTGGCTATTGTAAATGG - Intergenic
1198422830 X:136484897-136484919 GAGTATGTGCATTTTGAACAAGG - Intergenic
1199036352 X:143055075-143055097 GGCTATGTGTATATTCTACCAGG + Intergenic
1199391947 X:147290565-147290587 GTTTATGTACATGTTCTTCAGGG - Intergenic
1201172100 Y:11277142-11277164 GTGTACGTATAAATTCTACATGG + Intergenic