ID: 1141045192

View in Genome Browser
Species Human (GRCh38)
Location 16:80709707-80709729
Sequence CTGTGGAAGTAGATGTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141045192_1141045197 24 Left 1141045192 16:80709707-80709729 CCTTCTCACATCTACTTCCACAG 0: 1
1: 1
2: 1
3: 26
4: 304
Right 1141045197 16:80709754-80709776 TAAAGTGCCACATTTATTGTAGG 0: 1
1: 0
2: 2
3: 23
4: 207
1141045192_1141045196 1 Left 1141045192 16:80709707-80709729 CCTTCTCACATCTACTTCCACAG 0: 1
1: 1
2: 1
3: 26
4: 304
Right 1141045196 16:80709731-80709753 CCAACTTTCAGTCTTTTTTAAGG 0: 1
1: 0
2: 1
3: 76
4: 792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141045192 Original CRISPR CTGTGGAAGTAGATGTGAGA AGG (reversed) Intronic
901718849 1:11178933-11178955 TTGTAGAAGCAGATGTGAGCTGG + Intronic
902894396 1:19468849-19468871 TTGTTGAAGTGGAGGTGAGAGGG - Intronic
903966942 1:27096618-27096640 CTGTGTAAGTAGTTGTCAGCTGG - Intergenic
904102633 1:28045328-28045350 CTATGTAAGTAGGTGTGAGATGG - Intronic
906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG + Intronic
906907525 1:49911916-49911938 CTGTGCAAGCAGTTGTGAGCTGG - Intronic
906976109 1:50574639-50574661 ATGTGGAAGTAGATATAAGTAGG - Intronic
906994745 1:50780301-50780323 GAGTGGAAGCAGGTGTGAGAGGG + Intronic
909668888 1:78165916-78165938 CTGTGGTAGAAGCTGTCAGAGGG - Intergenic
909774501 1:79467101-79467123 ATGTGGAGGCAGGTGTGAGAAGG + Intergenic
910507616 1:87968047-87968069 CTCTGGAAGCAGATGTCTGAAGG + Intergenic
910899358 1:92103076-92103098 TTGTGAAAGTAGATTTCAGAAGG + Intronic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912476970 1:109944596-109944618 GACAGGAAGTAGATGTGAGAAGG - Intergenic
913164856 1:116175618-116175640 CGGTGGAAGAAGCTGTGAGAAGG + Intergenic
914206914 1:145539764-145539786 AAGTGGAAGTAGATGAGGGAAGG - Intergenic
916418468 1:164614174-164614196 GTGTGGAAGTACATGAAAGAAGG + Intronic
917326432 1:173837245-173837267 CTATGGTAGTAGATGTGAGAGGG + Intronic
917418728 1:174839326-174839348 GTGTGGATGTGCATGTGAGAGGG - Intronic
917560599 1:176150176-176150198 CTCTGGAAGTGGGTGTGAGGTGG - Intronic
918026603 1:180755600-180755622 TTGTGGAAGTGGGTGTCAGAAGG - Intronic
918632750 1:186738201-186738223 CTGTGGAGTTAGCTGTGAGAAGG + Intergenic
922251967 1:223857404-223857426 GAGTAGAAGCAGATGTGAGAGGG - Intergenic
923291027 1:232546353-232546375 CTGTGAAAGTAGATGAAAAATGG - Intronic
923821845 1:237452614-237452636 TTCTTGAAGTAGATGAGAGAGGG + Intronic
924149062 1:241109222-241109244 ATGAGGAAGTGTATGTGAGAAGG - Intronic
1063144543 10:3284690-3284712 CTATGGAGGCAGATGTGAGTAGG - Intergenic
1063498943 10:6536059-6536081 CTGGGGAAGCAGATGTGCGTGGG + Intronic
1064139082 10:12774991-12775013 TGGAGGAAGGAGATGTGAGAAGG + Intronic
1065461995 10:25977834-25977856 ATCTGGAAGTGGAAGTGAGATGG - Intronic
1065574910 10:27107915-27107937 CAATGCAAGTAGATTTGAGATGG + Intergenic
1065796925 10:29316246-29316268 TTGTGGAATCAGATGAGAGAAGG - Intronic
1066468290 10:35672245-35672267 CTGTGGAAGTAGCTGGGAGGAGG + Intergenic
1066612281 10:37262167-37262189 CTTTGCAGGTAGATGTGAAATGG - Intronic
1067337800 10:45378879-45378901 CTGTGGAAGTCCCTGTCAGATGG + Intronic
1068589884 10:58842680-58842702 CTATGGAAGTAGATTTAGGAGGG - Intergenic
1068895164 10:62190845-62190867 ATGTGGCAGTAGGTGAGAGATGG - Intronic
1071970669 10:90903089-90903111 CTGTCAAATTAGATATGAGAAGG + Intronic
1072241998 10:93505371-93505393 CTCTGTATGTAGCTGTGAGATGG + Intronic
1073978595 10:109128302-109128324 CCATGGAGGTAGTTGTGAGATGG + Intergenic
1073986650 10:109217197-109217219 AGGTGGAAGTAGATGTCAGTGGG - Intergenic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1078066661 11:8083223-8083245 CTGTGGAAGTACCTGTGTGCGGG + Intronic
1078788372 11:14519456-14519478 CTGTGGGAGTATATGTTAGGGGG - Intronic
1081205001 11:40264792-40264814 GTCTGGAAGAAGATGTGGGAGGG - Intronic
1081507499 11:43733720-43733742 GAGTGGAAGAAGGTGTGAGAGGG + Intronic
1082307379 11:50597011-50597033 CTGTGGAGGTATATTTGGGACGG + Intergenic
1084132858 11:67150681-67150703 CTGGGGAATTAGAGGTGAGTTGG + Intronic
1085433593 11:76479400-76479422 CTGTGGAAGTGCTTGTGTGAGGG - Intronic
1088454808 11:110022469-110022491 CTGTGGAAGGAAAGGGGAGATGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089114815 11:116086160-116086182 CTGTGGAAGTGGACTTGAGTGGG + Intergenic
1090008851 11:123027800-123027822 CTGTGGAAGCCGTGGTGAGATGG + Intergenic
1090417854 11:126552965-126552987 CTGGGGAAGAGGATGTGGGAAGG - Intronic
1091947973 12:4565923-4565945 CTATGAAAGTACATGTGGGATGG - Intronic
1094527654 12:31243041-31243063 CTACGGAAGAAGATGGGAGAGGG + Intergenic
1096005751 12:48169676-48169698 GAGTGGAAGCAGGTGTGAGAGGG - Intronic
1096377500 12:51125424-51125446 GAGTGGAAGCAGGTGTGAGAGGG - Intronic
1096572519 12:52531851-52531873 ATGGGGAAGTGGATGTTAGAGGG - Intergenic
1096820368 12:54229075-54229097 CTTTGGAAGTAAGTGTGAGCTGG - Intergenic
1097782521 12:63724499-63724521 CTGGAGAAGAAAATGTGAGAAGG + Intergenic
1099739280 12:86610801-86610823 CTGTAAAAGTAAATGAGAGACGG + Intronic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103578866 12:121899509-121899531 ATGTGGAGCTAGAGGTGAGAAGG - Intronic
1104245631 12:127038384-127038406 CTGTGGCAGTACATGTGACCAGG + Intergenic
1105048054 12:133022973-133022995 CTGTGGAAGAAGCAGTGAGTTGG + Exonic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105729087 13:23193504-23193526 CTGATGAAGTAGACGTGAGGTGG + Intronic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107527861 13:41251155-41251177 CTAAGTAACTAGATGTGAGAGGG - Intronic
1111388739 13:87562923-87562945 ATGTAGAAGTAGAAGAGAGAAGG + Intergenic
1112559965 13:100504032-100504054 GAGTGGGATTAGATGTGAGAGGG + Intronic
1112749535 13:102567954-102567976 CTGTGGAAGAAGCTGGGAGAGGG - Intergenic
1113734593 13:112669208-112669230 CTGAGTGAGAAGATGTGAGAAGG + Intronic
1114924831 14:27383747-27383769 CTGTGGTAGTACATATGAAACGG + Intergenic
1116099911 14:40420616-40420638 CAGTCAAAGTAGAGGTGAGAAGG + Intergenic
1117093916 14:52277962-52277984 CTGTGGAAGTTCAGGTGTGAGGG - Intergenic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118049019 14:62005659-62005681 GTGTGTAAGTAGATATGAGGAGG + Intronic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118646819 14:67848467-67848489 CTGTGGGATTACATGTGAGATGG + Intronic
1119370392 14:74135688-74135710 CTATGGCAATAGATGTGATAAGG - Intronic
1120216980 14:81690753-81690775 CTGTGGAGGGAGATTTGAGGAGG - Intergenic
1122180920 14:99953985-99954007 CTGTGGCAGGAGCTGAGAGATGG - Intergenic
1126744234 15:51809530-51809552 CTGTGAAAGTACAAGTGAGATGG + Exonic
1126785401 15:52174482-52174504 CTGTGGAGTTTGATGTGAGCTGG + Intronic
1126899184 15:53294677-53294699 CCCGGGAAGTAGATGTGACATGG + Intergenic
1127346411 15:58105176-58105198 CTCAGGAAGTTGAGGTGAGAGGG - Intronic
1127793376 15:62417872-62417894 CTCTGAAAGTGAATGTGAGATGG - Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1130002261 15:80058047-80058069 CTGTGTAAGTCAATGAGAGAAGG + Intergenic
1130237808 15:82154134-82154156 CTGTGGAAGGAAGTGTGTGATGG + Intronic
1130336103 15:82958567-82958589 CTCTGGCAGCAGATGGGAGAAGG + Intronic
1130796151 15:87211636-87211658 TTGTGGAAGAAGGTGTCAGAAGG + Intergenic
1132401472 15:101510038-101510060 GTGGGGAAGAAGATGTGAGAGGG - Intronic
1133876917 16:9743704-9743726 ATGTAGAAGAAGATGAGAGATGG + Intergenic
1134407640 16:13975910-13975932 CTATGAAAGTAGACGTGGGAAGG + Intergenic
1135229717 16:20694480-20694502 CTGTGGAAGGAGGTGTGTGTTGG - Intronic
1137341475 16:47611086-47611108 ATGAGGAAGTAGATTTCAGATGG + Intronic
1138718619 16:59052896-59052918 CTTTCAAAATAGATGTGAGAAGG + Intergenic
1140126086 16:72120078-72120100 CTGTGGAGGTGGCTGTGGGAAGG + Exonic
1141045192 16:80709707-80709729 CTGTGGAAGTAGATGTGAGAAGG - Intronic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1143156138 17:4837635-4837657 CAGTGGAAGTGGATGGGACAAGG + Intronic
1143251306 17:5525245-5525267 CTGTGGATGTAGCTGTGAACAGG + Intronic
1145967789 17:28932643-28932665 CTGCGGAAGGAGTTTTGAGATGG - Intronic
1147111592 17:38266248-38266270 CTGCAGAAGTAGTTGTGAAAAGG - Intergenic
1147278927 17:39341612-39341634 GTGAGGAAGTATATGGGAGAAGG - Intronic
1148110640 17:45143256-45143278 CTGGGGAGGAAGATGTGGGAGGG + Intronic
1148417982 17:47522553-47522575 CTGCAGAAGTAGTTGTGAAAAGG + Intergenic
1148690912 17:49526378-49526400 GTGTGGAAGTGGATCTGAGTGGG - Intergenic
1151035008 17:70788783-70788805 ATGTGGAAGTGCATGTGAGTTGG + Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1153507339 18:5814640-5814662 CTGTGTAAGAAGATTTGAGCAGG + Intergenic
1153936374 18:9928428-9928450 CAGTGGAAGTAACTGGGAGAGGG - Intronic
1154327207 18:13400217-13400239 CTGTGCAAGTGTATGTGACATGG - Intronic
1157493730 18:48140908-48140930 CTGTAGAAGTCAAGGTGAGAGGG - Intronic
1157605317 18:48922771-48922793 CTGTGGAAGGAGGGGAGAGAGGG - Intronic
1158084836 18:53638898-53638920 CTGTAGCAGAAGAAGTGAGATGG + Intergenic
1160503960 18:79417089-79417111 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503987 18:79417181-79417203 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503994 18:79417205-79417227 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504006 18:79417246-79417268 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504018 18:79417287-79417309 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504031 18:79417335-79417357 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504043 18:79417375-79417397 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504055 18:79417416-79417438 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504062 18:79417440-79417462 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504075 18:79417488-79417510 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504087 18:79417528-79417550 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504099 18:79417569-79417591 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504111 18:79417610-79417632 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504124 18:79417658-79417680 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504136 18:79417698-79417720 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504143 18:79417722-79417744 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504155 18:79417763-79417785 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504167 18:79417804-79417826 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504180 18:79417852-79417874 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504192 18:79417892-79417914 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504199 18:79417916-79417938 CTGTGGTGGGAGATGGGAGATGG + Intronic
1161044287 19:2126824-2126846 CTGTGGAAGCAGGTATGAGGAGG + Intronic
1161571433 19:5032843-5032865 CTGTGGAGGAAGACGAGAGAGGG - Intronic
1162300478 19:9842177-9842199 AAGTGGAAGAAGAAGTGAGAGGG + Intronic
1165245271 19:34494947-34494969 CTGGGGGAGCAGATGAGAGATGG + Intronic
1165673247 19:37697419-37697441 GAGTGGAAGCAGGTGTGAGAGGG - Exonic
1165736625 19:38180989-38181011 CTTTGGAAGGAGAGGAGAGAAGG - Intronic
1166145666 19:40833190-40833212 CTGTGGAGGAAGATGTAACATGG + Intronic
1166149775 19:40864092-40864114 CTGTGGAGGAAGATGTAACATGG + Intronic
925068005 2:944109-944131 CTTTGGAAGGAGATGTGTGTTGG + Intergenic
925262251 2:2538936-2538958 TTGTGGAAGTGGCTGTGAGAGGG - Intergenic
926213775 2:10890954-10890976 CTCTGGAAGCAGATGTGAGGAGG - Intergenic
926333028 2:11840833-11840855 TGGTGGAAGTAGATTTCAGATGG - Intergenic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
927148035 2:20179776-20179798 CTGTGGAGGGAGACGTGACAGGG - Intergenic
927338624 2:21954149-21954171 CTGTGGAGAGAGATGTCAGAGGG + Intergenic
927445209 2:23154502-23154524 CTGTGGAAGTATGTGTGTGGCGG + Intergenic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
929824340 2:45298687-45298709 CTGTGAGAGCAGCTGTGAGAGGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932196610 2:69789431-69789453 GTGTGGAATTTAATGTGAGAAGG + Intronic
933861122 2:86469285-86469307 CTGGGGAACTAGTTGAGAGATGG - Intronic
934591309 2:95552468-95552490 CTCTGGAAGCTGAGGTGAGAGGG - Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
935089030 2:99876413-99876435 CTGATGAAGTGAATGTGAGAGGG - Intronic
935547003 2:104410958-104410980 CTGAAGAAATAGAAGTGAGATGG + Intergenic
935635830 2:105248979-105249001 CTGTGGAAGAAGATGGGAGCTGG + Intergenic
936530341 2:113272004-113272026 CTTTGGATGTAAATGTGACATGG + Intronic
937499300 2:122461141-122461163 CTGTGGAAGCAGATGCGTCAAGG + Intergenic
939021232 2:136960675-136960697 CTATGGAAGGAGATTCGAGAAGG - Intronic
945428005 2:209731290-209731312 ATGTGAAAGTAGATGTTAGCAGG + Exonic
945932299 2:215867084-215867106 CTGTGGCAGAAGAGGTGAGAGGG - Intergenic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
1168812630 20:715652-715674 GGGTGGAAGCAGATATGAGAAGG + Intergenic
1170379372 20:15740143-15740165 ATGTGGAAGAATATGTGGGAGGG + Intronic
1170895709 20:20412035-20412057 CTGAGGGAGTAGCTGGGAGAGGG + Exonic
1171266186 20:23773821-23773843 CTGTGCATGTACATGTGAGTAGG - Intergenic
1173500010 20:43546241-43546263 CTGTGGAGCTAGGTGTGAGGAGG + Intronic
1175203231 20:57292136-57292158 CTGTGGGAGGTGATGTGAGGGGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1179303100 21:40130022-40130044 CTCTGAAGGTACATGTGAGAGGG - Intronic
1179469336 21:41600167-41600189 CTGTGCTACTAGATGTGAGCAGG + Intergenic
1183284749 22:36954817-36954839 CAGGGGAAGTAGAGGTGTGACGG - Intergenic
1185143448 22:49116780-49116802 CTGTGGAAGAGGACTTGAGAAGG + Intergenic
949397945 3:3635009-3635031 CTCTGGAAGCAGATGCCAGATGG - Intergenic
949682297 3:6528070-6528092 CTGTGGAAATAGATGTAATCTGG - Intergenic
949744937 3:7279684-7279706 TTATGGAAGTAGAGCTGAGAAGG - Intronic
949829519 3:8198987-8199009 CTGAGGAAGGATAAGTGAGAGGG - Intergenic
950264502 3:11564151-11564173 CTGGGGAAATATATGGGAGAAGG - Intronic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
951372158 3:21862768-21862790 CTGTGGCAGCAGATGTAACAGGG - Intronic
951855000 3:27186492-27186514 CTGCTGGAGTGGATGTGAGAAGG - Intronic
952276326 3:31880640-31880662 CAGTGGAAGATGAAGTGAGAAGG - Intronic
952935562 3:38395845-38395867 CACTGGCACTAGATGTGAGAAGG - Intronic
953253236 3:41265184-41265206 CTGTGGCCGTGGATCTGAGATGG - Intronic
954033973 3:47840526-47840548 CTTTGGAAGTTGAGGTGGGAGGG + Intronic
954037099 3:47856901-47856923 CTGTGGAAGTCGCTGTGCGGAGG - Intronic
954579621 3:51696237-51696259 CTGTGGAAGGGGATGTGCCAGGG + Intronic
954772448 3:52984036-52984058 ATGTGGAGGAAGATGTAAGATGG + Intronic
957985029 3:87562804-87562826 CTGTGGAAGGACATGCGACAAGG - Intergenic
959229738 3:103632627-103632649 CTGTGAAGGCAGCTGTGAGAGGG + Intergenic
959308757 3:104702961-104702983 CTGTGGAAGTAGGTTTGGTAGGG + Intergenic
959641923 3:108648378-108648400 CAGTTGAAGTGGATGTGGGAAGG + Intronic
959951822 3:112187743-112187765 ATGTGGAAGAAGAAATGAGAAGG - Intronic
960370730 3:116835050-116835072 CTGTGACATTAAATGTGAGATGG - Intronic
961577985 3:127854114-127854136 CTCTGGCAGTAGAGGTGACAAGG + Intergenic
963285921 3:143434650-143434672 CTAGGGCAGTAGCTGTGAGATGG - Intronic
963538887 3:146562113-146562135 CTGTGAAAGTAGCTGTGAGGGGG - Intergenic
964200968 3:154119277-154119299 CTGTAAAAGGTGATGTGAGAAGG - Intergenic
964857752 3:161165355-161165377 CTGTGGACGTAGAAATGGGAAGG - Intronic
965430029 3:168574855-168574877 CTGTGGAAGTAGATTTGAGAAGG + Intergenic
968938057 4:3623970-3623992 CTGTGGGAGCAGATGTGGGCGGG + Intergenic
971440503 4:26679700-26679722 CTGTGAAAGCAGCTGTGAGTGGG + Intronic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
973601519 4:52547345-52547367 CTATGGAAGTATCTGTGATAAGG + Intergenic
974584200 4:63850355-63850377 CTTGGGAAGTACATGTCAGATGG - Intergenic
975663082 4:76706877-76706899 CTGTGGAAGTCGGGGTGAGGTGG - Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975880001 4:78893805-78893827 CTCTGGAGGTTGAGGTGAGAGGG - Intronic
977531785 4:98208965-98208987 GAGTGGAAGTAGAAGTGAGACGG + Intergenic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978991294 4:115085006-115085028 CTGTGAAAGCAGATGTGAGGGGG + Intronic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
984548770 4:181136371-181136393 ATGTGGAAGTTCAAGTGAGAGGG - Intergenic
988351857 5:30118742-30118764 CTGAGGAAGGAGATGAGAAAAGG - Intergenic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
989398394 5:40982787-40982809 CTGTGGGAGGAGAAATGAGAGGG + Exonic
990973129 5:61531552-61531574 CTGTGGAAGTAGCCCTGATAGGG + Exonic
992366587 5:76097861-76097883 CTCTGGCAGTAGTTGAGAGAGGG + Intronic
992376728 5:76195187-76195209 ATATGGAAGGAGATGTGTGAAGG - Intronic
992655640 5:78907125-78907147 CTGGGGAATTAGAGGTGACACGG + Intronic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
995319308 5:110814030-110814052 CTCTGGATTTATATGTGAGAAGG + Intergenic
995679636 5:114702604-114702626 CTGTGGAAATAGATAACAGAAGG + Intergenic
997693308 5:135842651-135842673 CTTTAGAAGTAGATTGGAGATGG + Intronic
998079619 5:139263733-139263755 CTGTGGAAGGTCATGTGATAAGG + Intronic
998682075 5:144479662-144479684 CTTAGGAAGTAGAGGAGAGAGGG - Exonic
998932270 5:147194403-147194425 CTGAGGAAGAAGCTGTGTGAGGG + Intergenic
1001671874 5:173480493-173480515 CTGTGAAACTATATGTCAGATGG - Intergenic
1001798023 5:174518400-174518422 CTGCGGGACTAGATGTGCGAGGG - Intergenic
1002886199 6:1296557-1296579 CTAAGGAAGAAGATGTGAAAGGG + Intergenic
1002942590 6:1731410-1731432 GTGTGGAACTTGATGTGAGGTGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003923107 6:10852121-10852143 CTATAGAAAAAGATGTGAGATGG - Intronic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1004755996 6:18611006-18611028 CTGTTGAATTAGATCTGAGATGG + Intergenic
1006406034 6:33845573-33845595 CAGAGGAAGCAGATGTGAGAAGG - Intergenic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1007165791 6:39828029-39828051 CTGTGGGAGCACAGGTGAGAGGG - Intronic
1007343455 6:41208896-41208918 CAGGGGAAGTAGATCTAAGAGGG + Intergenic
1007657097 6:43456895-43456917 CTGTGGAGGTGGCTGTGTGAAGG - Intergenic
1008139368 6:47814202-47814224 TTGTGGAAGTGGATGACAGATGG + Intronic
1008581707 6:52913980-52914002 CAGTGGAAGGAGATGGGACAAGG + Intergenic
1009840443 6:69066153-69066175 ATGTGGATGTATATGTGTGAAGG - Intronic
1010432067 6:75788846-75788868 CTGAGGAAGGAGGTGGGAGAAGG + Intronic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1012868034 6:104641388-104641410 CTGTGGAAGAAGATTTGAAGGGG + Intergenic
1013010595 6:106116520-106116542 CTGTGGAGTTAGAAGTGAGATGG - Intergenic
1014059431 6:117053096-117053118 TTGTGGAGGGAGATGGGAGAGGG + Intergenic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1016618100 6:146076526-146076548 GTTTGGATGTAGGTGTGAGAAGG + Intronic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1017545377 6:155445370-155445392 GTGTGGAAGAAGATGTGATGGGG + Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1020520572 7:9180793-9180815 CTGTGGAGGCTGAAGTGAGAGGG + Intergenic
1021259661 7:18439470-18439492 CTGATGAAGCAGACGTGAGATGG - Intronic
1022645433 7:32224927-32224949 CTCTGGAAGGGGATGGGAGAAGG + Intronic
1022941125 7:35240605-35240627 CTGGAGAAGAAAATGTGAGAAGG + Intronic
1024612365 7:51078520-51078542 CTGTTGAAGTAGGTTTGAGATGG + Intronic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1031385806 7:121149518-121149540 CAGAGGAAGCAGATGTGAGTTGG - Intronic
1031418234 7:121518609-121518631 CAGTGAAGGGAGATGTGAGATGG + Intergenic
1031553877 7:123147877-123147899 CTTTGGGAGTAGTGGTGAGAAGG - Intronic
1031856743 7:126931936-126931958 CTTTGGAATTTGTTGTGAGAAGG - Intronic
1034206541 7:149320916-149320938 CTGTGAATGTAGAAGTGAGGGGG - Intergenic
1035174432 7:157040206-157040228 GCGTGGAAGTGGATGTGAGCCGG + Intergenic
1036124682 8:6052075-6052097 CAGTGGAAGAAGATGAGAAATGG - Intergenic
1036387721 8:8296375-8296397 CTTAGAAAGTGGATGTGAGAAGG - Intergenic
1036438519 8:8758750-8758772 CTGTGAAAGTGGAAATGAGATGG - Intergenic
1036854651 8:12231461-12231483 CTGTGGAGGTTGAAGTGGGAGGG + Intergenic
1036968715 8:13330070-13330092 CTGAGGAAGTTGAGGTGGGAGGG - Intronic
1038055746 8:23856093-23856115 TTGGGGAAGTAGATGAGAAATGG + Intergenic
1038125789 8:24671408-24671430 CTGAGAAAGCAGATGTGAGAAGG + Intergenic
1040391994 8:46958045-46958067 TTGTGGAAGAAGATGAGAGTGGG - Intergenic
1041391687 8:57352758-57352780 TTTTGGAAGTAGATGTGTGATGG - Intergenic
1041821820 8:62044563-62044585 CTGTATACGTATATGTGAGAGGG + Intergenic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045702187 8:104879959-104879981 CTGGGGAAATAAAAGTGAGATGG - Intronic
1046115661 8:109780260-109780282 CAGAGGAAGAAGAGGTGAGAAGG - Intergenic
1046549351 8:115694083-115694105 CAGTGGCATTAGATGTGAGATGG - Intronic
1046773048 8:118135906-118135928 GTGTGGAAGGAGATGTGGAAAGG - Intergenic
1047017491 8:120739012-120739034 CAGTTGAAGTGGGTGTGAGATGG + Intronic
1048610543 8:136017589-136017611 GTGTGGAAGTAGGTGAGATATGG + Intergenic
1049879655 8:145053028-145053050 TTGGGGAAGTGGCTGTGAGAGGG - Intronic
1050155070 9:2658158-2658180 GTGTGAAGGTAGATGTGAAAGGG - Exonic
1050660343 9:7877199-7877221 CTGTGAAAGTAGCTGGGAGGAGG + Intronic
1051007731 9:12367819-12367841 CTGGGGAAGGTAATGTGAGAAGG + Intergenic
1051588844 9:18755302-18755324 CAGTGGAGGTTGATTTGAGATGG - Intronic
1052013869 9:23443029-23443051 TTGGGGAAGGAGATGTGAGTAGG + Intergenic
1052695471 9:31871970-31871992 CTGTGGGAGAATCTGTGAGAGGG - Intergenic
1053277173 9:36791874-36791896 CTATAGAAATAGATGTGAAATGG + Intergenic
1055348244 9:75358949-75358971 CTGATGCAGTAGATGTGGGATGG + Intergenic
1055842588 9:80523225-80523247 TTGTGGGAGTAGATGTGACCTGG + Intergenic
1057014364 9:91638086-91638108 CTGTGGAATTAGAGTTGAGATGG + Intronic
1060683693 9:125588589-125588611 CAGTGGAGATAGAAGTGAGATGG - Intronic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1188329385 X:28850276-28850298 TTGCGGTAGGAGATGTGAGAGGG - Intronic
1189592020 X:42523576-42523598 CTGGGCAAGTACAGGTGAGAGGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1193012007 X:76687253-76687275 CTGTGTGATTAGCTGTGAGATGG + Intergenic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1193954964 X:87848650-87848672 CTGTCTAAATAGATGTGATAAGG + Intergenic
1194259100 X:91671777-91671799 TTGTGGAAGTAGGTTTCAGAAGG - Intergenic
1195418647 X:104648017-104648039 GAGTGGAAGCAGGTGTGAGAGGG - Intronic
1195444134 X:104931583-104931605 CTGTGGTATTATTTGTGAGAAGG + Intronic
1195638696 X:107149812-107149834 CTGTGGCAGTAGTAGTAAGAGGG - Intronic
1195865957 X:109432974-109432996 GTATAGATGTAGATGTGAGAAGG + Intronic
1196113579 X:111973210-111973232 CAGTGGAAATAGATGTAGGAGGG - Intronic
1196668502 X:118341859-118341881 TTGTGGAAGTAGGTATCAGAAGG + Intergenic
1197362234 X:125519217-125519239 CTGTGAAAGTACATGGAAGAAGG - Intergenic
1197422558 X:126256968-126256990 CTGTGTCATTGGATGTGAGATGG + Intergenic
1197609822 X:128625289-128625311 CTGTGCAAGTAGATGCTAAAAGG - Intergenic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200007146 X:153094658-153094680 CAGTGAAGGTAGATGGGAGAGGG + Intergenic
1200490606 Y:3818344-3818366 CTGTGTCAGTGCATGTGAGATGG - Intergenic
1200577798 Y:4910974-4910996 TTGTGGAAGTAGGTTTCAGAAGG - Intergenic
1201969340 Y:19774462-19774484 ATGGGCAAGTAGCTGTGAGAAGG - Intergenic