ID: 1141045870

View in Genome Browser
Species Human (GRCh38)
Location 16:80715767-80715789
Sequence GAGAGTGAGGAGGAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3192
Summary {0: 1, 1: 0, 2: 20, 3: 303, 4: 2868}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141045870_1141045878 10 Left 1141045870 16:80715767-80715789 CCTTCCATCTCCTCCTCACTCTC 0: 1
1: 0
2: 20
3: 303
4: 2868
Right 1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG 0: 1
1: 0
2: 1
3: 11
4: 103
1141045870_1141045874 -2 Left 1141045870 16:80715767-80715789 CCTTCCATCTCCTCCTCACTCTC 0: 1
1: 0
2: 20
3: 303
4: 2868
Right 1141045874 16:80715788-80715810 TCTGCCCTGCAGCCACTCTATGG 0: 1
1: 0
2: 1
3: 20
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141045870 Original CRISPR GAGAGTGAGGAGGAGATGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr