ID: 1141045874

View in Genome Browser
Species Human (GRCh38)
Location 16:80715788-80715810
Sequence TCTGCCCTGCAGCCACTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 257}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141045868_1141045874 5 Left 1141045868 16:80715760-80715782 CCCTTCACCTTCCATCTCCTCCT 0: 1
1: 0
2: 9
3: 166
4: 1694
Right 1141045874 16:80715788-80715810 TCTGCCCTGCAGCCACTCTATGG 0: 1
1: 0
2: 1
3: 20
4: 257
1141045871_1141045874 -6 Left 1141045871 16:80715771-80715793 CCATCTCCTCCTCACTCTCTGCC 0: 1
1: 4
2: 26
3: 341
4: 3037
Right 1141045874 16:80715788-80715810 TCTGCCCTGCAGCCACTCTATGG 0: 1
1: 0
2: 1
3: 20
4: 257
1141045867_1141045874 6 Left 1141045867 16:80715759-80715781 CCCCTTCACCTTCCATCTCCTCC 0: 1
1: 0
2: 20
3: 223
4: 1917
Right 1141045874 16:80715788-80715810 TCTGCCCTGCAGCCACTCTATGG 0: 1
1: 0
2: 1
3: 20
4: 257
1141045866_1141045874 10 Left 1141045866 16:80715755-80715777 CCTGCCCCTTCACCTTCCATCTC 0: 1
1: 1
2: 10
3: 79
4: 917
Right 1141045874 16:80715788-80715810 TCTGCCCTGCAGCCACTCTATGG 0: 1
1: 0
2: 1
3: 20
4: 257
1141045869_1141045874 4 Left 1141045869 16:80715761-80715783 CCTTCACCTTCCATCTCCTCCTC 0: 1
1: 0
2: 33
3: 409
4: 2959
Right 1141045874 16:80715788-80715810 TCTGCCCTGCAGCCACTCTATGG 0: 1
1: 0
2: 1
3: 20
4: 257
1141045870_1141045874 -2 Left 1141045870 16:80715767-80715789 CCTTCCATCTCCTCCTCACTCTC 0: 1
1: 0
2: 20
3: 303
4: 2868
Right 1141045874 16:80715788-80715810 TCTGCCCTGCAGCCACTCTATGG 0: 1
1: 0
2: 1
3: 20
4: 257
1141045865_1141045874 19 Left 1141045865 16:80715746-80715768 CCTGCACTTCCTGCCCCTTCACC 0: 1
1: 0
2: 2
3: 73
4: 827
Right 1141045874 16:80715788-80715810 TCTGCCCTGCAGCCACTCTATGG 0: 1
1: 0
2: 1
3: 20
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141045874 Original CRISPR TCTGCCCTGCAGCCACTCTA TGG Intronic
900760534 1:4467350-4467372 TCTCCCCTGCAGCCCCTCTGTGG - Intergenic
900836587 1:5009705-5009727 TCTGCACTGTAGTCACTCTTTGG + Intergenic
901125463 1:6925608-6925630 TCTGCCCTCCAGCCACTCCTTGG + Intronic
901616168 1:10541465-10541487 TCTGCACTGGACCCACACTAGGG - Intronic
901800005 1:11703117-11703139 TCTGCTCTGCGGCCCCTCCAGGG - Intronic
902236339 1:15059976-15059998 TCTTCCCAGCAGCTGCTCTATGG + Intronic
902982777 1:20137872-20137894 TCTGCCCAGCTGCCTCTCTGTGG - Intergenic
904473674 1:30751129-30751151 TAGGCCCTTCAGCCACTCTCTGG + Intronic
906674592 1:47684061-47684083 CCTGCCCTGCAGCCTCTCAGAGG - Intergenic
908186095 1:61654597-61654619 TGTGCCCTGCAGCCCTTCAAAGG + Intergenic
910985443 1:93000500-93000522 TCTGCCCCGCAGCCCCTCCTAGG - Intergenic
911310860 1:96290160-96290182 TTTGCTCTGCAGCCCCACTAGGG - Intergenic
911635579 1:100231907-100231929 GCAGCCTTGCAGCCACTGTAAGG + Intronic
912518709 1:110231224-110231246 TGGGCCCTGCAGCCAGTCCATGG - Intronic
915752186 1:158221800-158221822 ACTGTCCTGCACCCACTCTCTGG + Intergenic
920933804 1:210412626-210412648 TCTGCCCTCCAGGCCCACTAGGG + Intronic
921906123 1:220497245-220497267 GCTGCCCTGCAGCATCTCAATGG - Intergenic
922746182 1:228045460-228045482 TCTGCCCTGCTTCCCTTCTAGGG - Intronic
923858813 1:237872365-237872387 TTTGCCTTTCAGCCACTCTGTGG - Intergenic
1064914602 10:20442202-20442224 ACTGTCCTGCACCCACTCTCTGG + Intergenic
1066485875 10:35844129-35844151 TCTATCCTGCAGCCTCACTAGGG + Intergenic
1067055281 10:43046323-43046345 TCTGCCCTGCACCCGGTCCAAGG - Intergenic
1067789698 10:49278400-49278422 TCTGCCTTCCAGGCACTCTGTGG + Intergenic
1068511241 10:57968453-57968475 CCTGCCCTGCACACACTCTGTGG - Intergenic
1070892974 10:79956291-79956313 ACTGTCCTGCAACCACTCTCTGG - Intronic
1071799556 10:89043400-89043422 TGTGCCATGCAGCCACTGTAGGG + Intergenic
1071925299 10:90400539-90400561 GTTGCCCAGCAACCACTCTATGG + Intergenic
1074639899 10:115368403-115368425 ACTGACCTGCACCCACTGTATGG + Intronic
1074683214 10:115931917-115931939 ACTGCCCTGCATCCACTCCATGG - Intronic
1076111480 10:127862935-127862957 TTTGCACTGCAGCCAGTCTTTGG - Intergenic
1076626747 10:131825373-131825395 GCTGACCTGAAGCCCCTCTAGGG + Intergenic
1077047245 11:552032-552054 CCTGCCCTGCCGCCATTCCAGGG + Intronic
1077094486 11:793498-793520 TCTGCCTGGCAGACACTCGAGGG - Intronic
1077170167 11:1162538-1162560 GCTGCCCTTCAGCCAGTCTGGGG + Exonic
1078695695 11:13629097-13629119 ACTGTCCTGCACCCACTGTATGG + Intergenic
1078931862 11:15918750-15918772 TCTTCCCTGCACACACTCTCTGG + Intergenic
1079760150 11:24319196-24319218 TGTGCCATGCAGCCACTCCTAGG + Intergenic
1081770521 11:45647985-45648007 TGTGACCTGCAGCCACCCCAGGG + Intergenic
1082013660 11:47468185-47468207 TCTTCCCTGGAGCGACTCTGGGG - Intronic
1082078651 11:47994904-47994926 TCTACCCTGCAGACCCTCTGGGG + Intronic
1082134715 11:48533928-48533950 ACTGTCCTGCACCCACTCTCTGG + Intergenic
1082155483 11:48804460-48804482 ACTGTCCTGCAGCCACTGTCTGG + Intergenic
1083431797 11:62617092-62617114 TCTGCCCCGGAGCCAGTCCAGGG + Exonic
1083485988 11:62983421-62983443 CCTGCCCTCCAGCCTCTCTCGGG - Intronic
1083755554 11:64789943-64789965 ACTGTCCTGCAGGCACACTATGG + Exonic
1085444061 11:76589134-76589156 CCTGCCCTGCAGCCACTGCCAGG - Intergenic
1087619784 11:100528372-100528394 TCTTCCCTCCATCCACTCTCAGG - Intergenic
1088149249 11:106724215-106724237 TCAGCCCTGCAAGCAGTCTAAGG + Intronic
1088978169 11:114834250-114834272 TCTGCACTGGAGCCACACTGGGG + Intergenic
1089905514 11:122033870-122033892 TCTTCCCAGAAGCTACTCTAAGG + Intergenic
1091180562 11:133600628-133600650 TCTGCCCTACAGCTTTTCTAAGG + Intergenic
1091805517 12:3353322-3353344 TCTGCCCTGCAGTCAGTCCATGG + Intergenic
1092154757 12:6274850-6274872 CCTGCTCTGCAGCCCCTCTCAGG + Intergenic
1092263220 12:6963304-6963326 TCTCCCCAGCACCCACTCTCTGG + Intergenic
1094810514 12:34133461-34133483 TCTGTCCTGCACCCACTGTCTGG - Intergenic
1094873590 12:34614513-34614535 ACTGCCCTGCACCCACTGTCTGG + Intergenic
1097533746 12:60839098-60839120 TCTGCCATGCAGACACAGTAAGG - Intergenic
1098243265 12:68489083-68489105 CCAGCACTGCAGCCAATCTAAGG + Intergenic
1100725503 12:97404521-97404543 CCTGACCTGCAGCCAATCGAGGG - Intergenic
1110364758 13:74669437-74669459 TCTGCCCTTCAGGCACACTAAGG - Intergenic
1110812206 13:79823073-79823095 ACTGTCCTGCACCCACTCTCTGG + Intergenic
1111004323 13:82229136-82229158 ACTGACCTGCACCCACTCTCTGG - Intergenic
1113361753 13:109638289-109638311 TCTGCCCTGCCCCCACACCACGG + Intergenic
1113468344 13:110527467-110527489 TGTGCCCTGCTGCCAGTCTGAGG + Intronic
1113785438 13:112999952-112999974 TCAGCCCTGCCTCCACTCTGGGG - Intronic
1113785456 13:113000017-113000039 TCAGCCCTGCCTCCACTCTGGGG - Intronic
1121519245 14:94574636-94574658 TGTGCCCTTCACCCACTCCATGG - Intronic
1121845712 14:97170281-97170303 TCTGCCCTGCAGCTCCTGTTTGG - Intergenic
1121956013 14:98214066-98214088 TCTGCTCCACAGCCACTCCAAGG + Intergenic
1122315523 14:100824164-100824186 TCAGCCCTGCAGCCCCACAAGGG - Intergenic
1124247268 15:28081700-28081722 TCTGCCCGGCAGCCCCCCTGGGG + Exonic
1124625124 15:31303255-31303277 TGTGCCCTGTAGGCACTCTGAGG - Intergenic
1125327635 15:38553149-38553171 TTTTCCTTCCAGCCACTCTAGGG + Intronic
1125768532 15:42150470-42150492 TCTGCGCTGGGGCCACTCTGTGG + Exonic
1126766191 15:52013771-52013793 TCTGCCCTGTATCCAATGTACGG - Intronic
1126816455 15:52459730-52459752 TCTGCCCGGCAGCCCCTTTTGGG - Intronic
1128142586 15:65312446-65312468 TGTGCCCAGCTGCCCCTCTAAGG - Intergenic
1129975939 15:79821773-79821795 TCTGCCACCCAGCCACTCTGAGG + Intergenic
1130554783 15:84915049-84915071 GCTGCCCTGCAGTCCCTCTCAGG + Intronic
1130663870 15:85853136-85853158 TTTGGCCTGCAGACACTCCAGGG + Intergenic
1131038532 15:89241897-89241919 GCTGCCCTGTAGCCACCCTTTGG - Intergenic
1133040331 16:3057188-3057210 GATGGCCTGCAGCAACTCTATGG + Exonic
1135548240 16:23379788-23379810 TCTGCCCAGCACCCATCCTATGG - Intronic
1136606527 16:31337995-31338017 ACTGTCCTGCACCCACTCTCCGG - Intergenic
1138414041 16:56861112-56861134 TCTGCCCCTCTGCCTCTCTATGG - Intergenic
1141045874 16:80715788-80715810 TCTGCCCTGCAGCCACTCTATGG + Intronic
1141057345 16:80830859-80830881 CCTGTCCTGCAGCCACACTCCGG + Intergenic
1141630640 16:85286059-85286081 TCTGGCCTGCAGCCCCTCCCCGG + Intergenic
1142103798 16:88291266-88291288 TCTGCCCAGCAGGGACTCCAGGG + Intergenic
1142604334 17:1073334-1073356 TCTGCCCTGCAGCTGCTCCAAGG + Intronic
1142679972 17:1541499-1541521 TCTGCCTTGTAGCCTCTCCAGGG - Intronic
1143163471 17:4886013-4886035 TCCTCCCTACAGCCACTCTCTGG - Intronic
1146943925 17:36861551-36861573 CCTGCCCTGCTGCCACACTGAGG - Intergenic
1147583429 17:41639183-41639205 TCTGCCCTGCAGCCTGGCTGAGG + Intergenic
1148047709 17:44754044-44754066 GCTGCCCTGATGCCACTCTTGGG - Intergenic
1148084900 17:44988077-44988099 TCAGCCCGGGAGCTACTCTATGG + Intergenic
1151924965 17:77188508-77188530 ACTGCGCTGCAGCCACACCACGG - Intronic
1158964744 18:62612429-62612451 CCTGCCCTGCTGCCACCTTATGG + Intergenic
1160283606 18:77518026-77518048 TCTGCCCTGCAGCCTCTTGGGGG - Intergenic
1162224086 19:9205204-9205226 TCTGCCGTGCAGCCTCTGCAGGG - Intergenic
1163167236 19:15506805-15506827 TGTCCCCTGCAGCCACTGGAGGG + Intergenic
1163665000 19:18598993-18599015 TCTGCCCTCCTTCCACTCCAAGG - Intronic
1163972038 19:20807848-20807870 ACTGTCCTGCAGCCACTGTCTGG - Intronic
1164418659 19:28067587-28067609 TCTGCCATGGAGCCACTGGATGG - Intergenic
1164605724 19:29596542-29596564 TCTGCCCGGCACCCACACTACGG + Intergenic
1164820396 19:31245918-31245940 ACTTCTCTGCAGCAACTCTAGGG + Intergenic
1166027029 19:40096055-40096077 TCTGCTCTTCAGGCATTCTATGG - Intergenic
925386976 2:3468693-3468715 TGTGCACTGGAGTCACTCTATGG - Intronic
926124313 2:10262597-10262619 TCTCCCTTGCAGCCACTAGAAGG + Intergenic
927223477 2:20737631-20737653 TCTGCCCTAGAGTCACTCTGTGG - Intronic
927671569 2:25072822-25072844 TCTCCCCTCCAGCTACTCTCAGG + Intronic
928091061 2:28375390-28375412 TCCCCTCTGCAGCCACTCCAAGG - Intergenic
929149656 2:38736141-38736163 TCTCCCCTGCTGCCACTATGGGG + Intronic
929856170 2:45640235-45640257 ACTGCATTGCAGCAACTCTAAGG + Intergenic
930489126 2:52045405-52045427 ACTGACCTGCACCCACTCTCTGG + Intergenic
930571312 2:53089995-53090017 TCTGCTCTCCAGGCACCCTAGGG + Intergenic
930873088 2:56186145-56186167 TCCTACCTGCACCCACTCTAGGG - Intronic
933320926 2:80774624-80774646 TCTGCTCTGCAACCTCTCCAAGG + Intergenic
933568163 2:83976520-83976542 ACTGTCCTGCACCCACTCTCTGG - Intergenic
933840132 2:86279787-86279809 TCTCCCCTGGAGCCACTAAACGG + Intronic
933900764 2:86848504-86848526 TCTGCCCCTCAGCTACTCAAGGG - Intronic
936094955 2:109524263-109524285 TCTGACCTCCATCCACTGTAAGG + Intergenic
936157909 2:110061161-110061183 ACTTGCCTGCAACCACTCTAGGG + Intergenic
936186783 2:110310286-110310308 ACTTGCCTGCAACCACTCTAGGG - Intergenic
936267812 2:111023678-111023700 TCTGCCCTCCAGCCACGCTGAGG - Intronic
937634070 2:124136034-124136056 TGTGCCATGCAGCTAATCTACGG + Intronic
938071426 2:128310410-128310432 TCTGCCCTGAACTCCCTCTAGGG - Intronic
938548115 2:132353247-132353269 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
938653977 2:133412029-133412051 TCTGCCCTGCAGCCCCCTGATGG + Intronic
940779988 2:157923104-157923126 TCTGCCCTTGAGGCACTCCAAGG + Intronic
941584923 2:167346244-167346266 TATGCCCCACACCCACTCTAGGG + Intergenic
942606873 2:177701182-177701204 TCTGCCCTGGCCCAACTCTATGG - Exonic
945351317 2:208784381-208784403 ACTGTCCTGCACCCACTCTCTGG - Intronic
945939207 2:215931735-215931757 TCTGCCCTTCAGGGACTCTCAGG - Intergenic
946037416 2:216755087-216755109 TCTGCCCTGAAGACTCTCCAAGG + Intergenic
946880671 2:224174293-224174315 TCTGTCCAGCTGCCAGTCTATGG + Intergenic
947586628 2:231360700-231360722 TCTGCTCTGGAGCCCCTCTAAGG - Intronic
948408805 2:237743209-237743231 TCAGCCCTGCAGGCTCTGTAGGG + Intronic
948722604 2:239911051-239911073 TCTGCCCAGCAGACCCACTAGGG - Intronic
1169066834 20:2698515-2698537 TCTCCCCTGCAGGCACCCTCTGG - Intronic
1170838471 20:19904840-19904862 TCTTCCCTGGAGTCACTCAAAGG + Intronic
1171225130 20:23436348-23436370 CCTGCCCTGCAGCCACAGTTGGG + Intergenic
1171335263 20:24379783-24379805 CCTGCCCAGCAGCCACTCCCAGG - Intergenic
1171876984 20:30586019-30586041 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1173005780 20:39138680-39138702 TCTGCCCTGCATGCAATCCAAGG - Intergenic
1174694449 20:52543067-52543089 ACTGTCCTGCAGCCACTGTCTGG - Intergenic
1176105150 20:63382386-63382408 TCTGCCCTGATGCCACCCGAAGG - Intergenic
1178876612 21:36419115-36419137 TCAACCCAGCAGCCACTGTAAGG - Intergenic
1179450793 21:41467018-41467040 GCTGCCCAGGAGCCACTCGATGG + Intronic
1180183015 21:46126377-46126399 TCTGCCCTGCAGCCCCGAGAGGG - Intronic
1181133003 22:20745088-20745110 TCTCCCCTTCAGCCCCTTTACGG - Intronic
1181236280 22:21449636-21449658 TCTGCCCGTGAGCCACTCCAGGG - Exonic
1181728518 22:24827959-24827981 CCTCCCCAGCATCCACTCTAAGG - Intronic
1182873442 22:33669053-33669075 TCCACTCTGCTGCCACTCTATGG - Intronic
1182983030 22:34690007-34690029 TTTGGACTTCAGCCACTCTAAGG - Intergenic
1183669186 22:39262371-39262393 TCTGCCCTGTAGCCCCACTTGGG - Intergenic
1184199558 22:42957708-42957730 TCTGCCTTTCAGCCCCTATAAGG - Intronic
1184529275 22:45044201-45044223 TCTCCCCTGCAGCCTCTAGAAGG + Intergenic
1185373206 22:50470282-50470304 TCTGCACTGCAGCCTCCCCAAGG + Intronic
949600906 3:5596810-5596832 ACTGTCCTGCACCCACTCTGTGG + Intergenic
950479896 3:13237744-13237766 CCTGCCCTGAGGCCACTCTGTGG + Intergenic
950501070 3:13364234-13364256 TCTGCCCTGGTGCAACTCTAGGG + Intronic
953556158 3:43948480-43948502 TGTGCCCTGCAGCATCTCTTGGG - Intergenic
954648647 3:52146291-52146313 TCTGCCCTGCAGCCACCCCTGGG - Intronic
954977939 3:54714450-54714472 TCAGTCCTGTAGCCACTCTCAGG + Intronic
955099340 3:55831740-55831762 ACTGTCCTGCACCCACTCTCTGG - Intronic
956460238 3:69464393-69464415 TCTGGCCTGCAGACAGTCTATGG - Intronic
956745889 3:72310828-72310850 CCTGCCTTGCAGGCACTCTGGGG - Intergenic
957169928 3:76725003-76725025 TGTTCCCTGCAGAGACTCTAGGG - Intronic
957937975 3:86968748-86968770 TCTGCCCTGGATCCATCCTATGG - Exonic
958155164 3:89747739-89747761 ACTGACCTGCACCCACTCTCTGG - Intergenic
959056651 3:101574179-101574201 CCTCCCCTGCAGCCACGCCAAGG - Exonic
961652492 3:128423883-128423905 TCTGCCCTGCAGCCAATGCCTGG + Intergenic
962374322 3:134847525-134847547 TCTTCCCTGCAGCCACCAGAAGG - Intronic
963139749 3:141937634-141937656 ACTGCCCTGCAGCACCTCCATGG + Intergenic
964790955 3:160452888-160452910 TCTGCCCCGGAGCCAGTCCAGGG - Intronic
965623949 3:170668382-170668404 ACTGTCCTGCACCCACTCTCTGG + Intronic
965886451 3:173452060-173452082 TCTGTCCTGCACCCACTGTCTGG + Intronic
968376879 4:51109-51131 CTTGGCCTGCAGCCACTCCAAGG - Intergenic
968464514 4:743811-743833 TCTGCCCCCCAGACACTCTCGGG - Intronic
969846392 4:9923412-9923434 ACTGCCCTGCTGACACTGTACGG + Intronic
972764210 4:42136245-42136267 TCTACACTGCATCTACTCTAAGG + Intronic
973188087 4:47354679-47354701 TCTTCTCTGCAGCCACTTTCAGG - Intronic
973808830 4:54550585-54550607 TCTGTCCTGCTGCCACTTTCCGG + Intergenic
976354240 4:84097367-84097389 ACTGCCCTGCTGACACTGTATGG - Intergenic
980229602 4:130032220-130032242 CCTTGCCTGCAGCCATTCTATGG + Intergenic
981439650 4:144768673-144768695 ACTGTCCTGCACCCACTCTCTGG - Intergenic
984118502 4:175712316-175712338 GCTGCCCTGCGGCCACACTATGG + Intronic
984465298 4:180092912-180092934 TGTGACATTCAGCCACTCTAGGG + Intergenic
985697012 5:1346370-1346392 CCTGCTCTCCAGCCACTCTTGGG + Intergenic
986137060 5:4990304-4990326 ACTGCCCTGCTGACACTGTACGG + Intergenic
988871534 5:35396211-35396233 ACTGTCCTGCACCCACTCTCTGG - Intergenic
992444450 5:76821057-76821079 TCGGCCCTGCAGCCACCTGAGGG - Intronic
993220977 5:85096957-85096979 TCAGGCCTTCAGTCACTCTAAGG + Intergenic
994281134 5:97903150-97903172 ACTGTCCTGCAGCCACTGTCTGG + Intergenic
995436889 5:112146204-112146226 TCTGCCTTTCAGCCATTCTTGGG + Intronic
996716222 5:126590066-126590088 TCTGCCCAGCTGCCACTGTCTGG + Intronic
997527782 5:134564565-134564587 TCTGTCCTGCAGCCTCTGCAAGG + Exonic
1001690637 5:173629994-173630016 TAGGCCCTGCAGCCACCCTAGGG + Intergenic
1001891985 5:175347190-175347212 TCTGCTTTTCAGCCACTCTTTGG + Intergenic
1002640515 5:180628557-180628579 TCTGCCCTGCAGAATCTCCAGGG - Intronic
1003617334 6:7667605-7667627 CCCGCCCTGCTTCCACTCTAAGG - Intergenic
1003655270 6:8001423-8001445 ACTTCCCTGCAGCCAGTCTTAGG - Intronic
1004014025 6:11716168-11716190 TCTACCCCGCAGTCACTCTGAGG + Intronic
1004225178 6:13778465-13778487 TTTGCCATGCACCCACCCTAAGG + Intergenic
1006278235 6:33023011-33023033 TCTGCCCTCCAGGCACACTGGGG - Intergenic
1006898723 6:37486569-37486591 CCTGCCCTGCAGCCCCACCATGG + Intronic
1010185165 6:73135520-73135542 TCTCCCCTGCCCCTACTCTAGGG + Intronic
1010518613 6:76804964-76804986 TCTTCCATGCAGCCGTTCTAAGG - Intergenic
1010760414 6:79716175-79716197 CTTACCCTGCAGCCACTCTGTGG - Intergenic
1011471988 6:87717323-87717345 TCTTCCCTACACCCACTCTCAGG - Intergenic
1012080931 6:94757892-94757914 ACTGTCCTGCACCCACTCTCTGG - Intergenic
1015436152 6:133191470-133191492 TCTGAACTCCAGCCACTCTACGG + Intergenic
1018216805 6:161536244-161536266 TCAGCTCTGAAGCCACTCCATGG - Intronic
1019265715 7:116463-116485 TCTGGCCTTCACCCACACTATGG + Intergenic
1020538922 7:9436518-9436540 ACTGTCCTGCACCCACTCTCCGG - Intergenic
1020747223 7:12092743-12092765 ACTGCCCTGCTGACACTGTAAGG + Intergenic
1022439409 7:30420814-30420836 TCTTCCCTGCAGCCAGTCATTGG + Intergenic
1022471936 7:30687306-30687328 GCTGCCTAGCAGCCACTCTGGGG - Intronic
1022576989 7:31507081-31507103 ACTGACCTGCACCCACTCTCTGG + Intergenic
1023106316 7:36766215-36766237 TCTTCCCTGCACCCACTCTATGG - Intergenic
1023856124 7:44185442-44185464 TCTGCCTTGAAGCCACCCCAAGG - Intronic
1024082449 7:45866270-45866292 TCAGCCCTCCAGCCACTGTTAGG - Intergenic
1024670831 7:51592956-51592978 TCTGCCCCACAGCCTCTCTCAGG + Intergenic
1024760784 7:52594109-52594131 CCTGCCTTCCAGACACTCTAGGG - Intergenic
1024784114 7:52886577-52886599 TCTGGGCTGCAGACACTCTGGGG - Intergenic
1025601214 7:62999206-62999228 ACTGTCCTGCACCCACTCTCTGG + Intergenic
1026676932 7:72435981-72436003 TTTCCCTTGCAGCCACTCTGAGG - Intronic
1027921644 7:84403036-84403058 ACTGTCCTGCACCCACTCTCCGG - Intronic
1028384429 7:90238685-90238707 ACTCACCTGCTGCCACTCTATGG - Intergenic
1033579177 7:142716017-142716039 TCTGCAATGCAGCCACTCTGTGG + Intergenic
1034068623 7:148161050-148161072 TCTGCCATTCAGCCCCTCCAAGG + Intronic
1035161484 7:156953498-156953520 TCTCCCCTGCTGCCCCTCCATGG + Intronic
1035196841 7:157228998-157229020 TCTGCCCTGGAGCATCTCAAGGG - Intronic
1035708633 8:1695960-1695982 TCTTCTCTGCAGCCACACGAGGG - Intronic
1036359737 8:8068551-8068573 ACTGCCTGGGAGCCACTCTAAGG - Intergenic
1036544502 8:9753918-9753940 TCTCCCCTACAGCCTCTGTAGGG - Intronic
1038645796 8:29361121-29361143 TCTACCCAGCAGGCACTGTAAGG + Intergenic
1039422981 8:37460405-37460427 ACTGTCCTGCACCCACTCTCTGG - Intergenic
1040460328 8:47641670-47641692 GCTCCCCTGCAGCCTCTCAAGGG + Intronic
1041144420 8:54858904-54858926 TCTGCAGTGAAGCCACTCTATGG - Intergenic
1041295917 8:56357202-56357224 ACTGTCCTGCACCCACTCTCTGG + Intergenic
1042193798 8:66214479-66214501 GCTGTCATCCAGCCACTCTAAGG + Intergenic
1042907262 8:73784672-73784694 TCAGACTTGCACCCACTCTAGGG - Intronic
1044528675 8:93282548-93282570 TCAACTCTGCAGCCACTATAGGG + Intergenic
1045707885 8:104947772-104947794 TCTGCCCTCCAGCCCCTCCGTGG + Intronic
1046863356 8:119118995-119119017 TCTGCCCTCCAACCATTCTGGGG + Intergenic
1047207110 8:122811482-122811504 CCTGCCCTGCATCCACGCCATGG + Intronic
1047331874 8:123896862-123896884 GCTGCCCTGCAGCTATTCTAGGG + Intronic
1048302906 8:133264800-133264822 TCTGGCCAGAAGCCACTCCAAGG + Intronic
1049097171 8:140555830-140555852 TCTGCCCTGCGACCCCTCTCAGG - Intronic
1050704956 9:8386350-8386372 TCTTCCCTGCTGCAAATCTATGG + Intronic
1051668159 9:19484612-19484634 TCTGCACTGCAGCCACCTAATGG + Intergenic
1052253211 9:26424182-26424204 TCTGCCTTGCAGCAAGTTTATGG - Intergenic
1052872640 9:33523669-33523691 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1053752320 9:41269184-41269206 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1053752770 9:41273441-41273463 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054257847 9:62833516-62833538 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054258295 9:62837793-62837815 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054333475 9:63782248-63782270 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1057137842 9:92706632-92706654 TCTGCCCTCCAGGCCCACTAAGG + Intergenic
1057207017 9:93179524-93179546 GCTGCCCTGCAGCATCTCCAAGG - Intergenic
1057442026 9:95090102-95090124 TCTGCCCTCCAGCCCCTCAGTGG - Intergenic
1057609187 9:96525562-96525584 TCTGCCCTCCAGGCCCTCTAGGG - Intronic
1057948621 9:99352019-99352041 TCTCCCATGCAGCCACTATTTGG + Intergenic
1060952349 9:127612284-127612306 TCCGCCCCGCAGCCGCGCTAGGG - Exonic
1060998252 9:127886921-127886943 TCTACCCTGCACCCATTTTATGG - Intronic
1061567197 9:131448956-131448978 TCTGCCCTGCCACCGCTCAAGGG + Intronic
1202800478 9_KI270719v1_random:170582-170604 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1202800924 9_KI270719v1_random:174864-174886 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1203572354 Un_KI270744v1:143137-143159 CTTGGCCTGCAGCCACTCCAAGG + Intergenic
1186394834 X:9197189-9197211 TGTGCCTTCCAGCCACTCTCAGG - Intergenic
1191092220 X:56635574-56635596 TCTGTCCTGCACCTACTCTCTGG + Intergenic
1191706310 X:64097963-64097985 TCAGCCGTAAAGCCACTCTATGG - Intergenic
1191751726 X:64549794-64549816 ACTGTCCTGCACCCACTCTCTGG + Intergenic
1192877488 X:75247219-75247241 ACTGTCCTGCACCCACTCTCTGG - Intergenic
1193582786 X:83285838-83285860 ACTGTCCTGCACCCACTCTCTGG + Intergenic
1199883543 X:151995967-151995989 TCTACCCTGAAGCCAATCTTTGG - Intergenic
1199984169 X:152938466-152938488 TCTGCCCTCCAGGAACTCTCAGG + Intronic