ID: 1141045878

View in Genome Browser
Species Human (GRCh38)
Location 16:80715800-80715822
Sequence CCACTCTATGGAATCATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141045871_1141045878 6 Left 1141045871 16:80715771-80715793 CCATCTCCTCCTCACTCTCTGCC 0: 1
1: 4
2: 26
3: 341
4: 3037
Right 1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG 0: 1
1: 0
2: 1
3: 11
4: 103
1141045868_1141045878 17 Left 1141045868 16:80715760-80715782 CCCTTCACCTTCCATCTCCTCCT 0: 1
1: 0
2: 9
3: 166
4: 1694
Right 1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG 0: 1
1: 0
2: 1
3: 11
4: 103
1141045867_1141045878 18 Left 1141045867 16:80715759-80715781 CCCCTTCACCTTCCATCTCCTCC 0: 1
1: 0
2: 20
3: 223
4: 1917
Right 1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG 0: 1
1: 0
2: 1
3: 11
4: 103
1141045869_1141045878 16 Left 1141045869 16:80715761-80715783 CCTTCACCTTCCATCTCCTCCTC 0: 1
1: 0
2: 33
3: 409
4: 2959
Right 1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG 0: 1
1: 0
2: 1
3: 11
4: 103
1141045866_1141045878 22 Left 1141045866 16:80715755-80715777 CCTGCCCCTTCACCTTCCATCTC 0: 1
1: 1
2: 10
3: 79
4: 917
Right 1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG 0: 1
1: 0
2: 1
3: 11
4: 103
1141045870_1141045878 10 Left 1141045870 16:80715767-80715789 CCTTCCATCTCCTCCTCACTCTC 0: 1
1: 0
2: 20
3: 303
4: 2868
Right 1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG 0: 1
1: 0
2: 1
3: 11
4: 103
1141045872_1141045878 0 Left 1141045872 16:80715777-80715799 CCTCCTCACTCTCTGCCCTGCAG 0: 1
1: 2
2: 15
3: 105
4: 795
Right 1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG 0: 1
1: 0
2: 1
3: 11
4: 103
1141045873_1141045878 -3 Left 1141045873 16:80715780-80715802 CCTCACTCTCTGCCCTGCAGCCA 0: 1
1: 0
2: 18
3: 99
4: 785
Right 1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG 0: 1
1: 0
2: 1
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141045878 Original CRISPR CCACTCTATGGAATCATCCA TGG Intronic
903172888 1:21564456-21564478 TCAATTTATGGAATCATCCCTGG - Intronic
904865714 1:33577436-33577458 CCACTCCATGGCTTCATCCTAGG - Exonic
905263447 1:36735047-36735069 CCACTGGATGGTCTCATCCACGG - Intergenic
906555685 1:46711050-46711072 CCAATATATGGAATCAACCTAGG - Intronic
907024018 1:51097499-51097521 CCAAGATATGGAATCAACCAAGG + Intergenic
909205248 1:72748334-72748356 GCAATCTATGAAATCATCTAGGG - Intergenic
912839996 1:113030879-113030901 ACACTCTATGGAATTATCTATGG - Intergenic
916281919 1:163061210-163061232 CCTCACTATGGAATCGTCCTTGG + Intergenic
924369281 1:243330747-243330769 CCAGCCTATGGAATCATCAATGG - Intronic
1064669881 10:17701833-17701855 CCAGTATATGAAATCATCCCTGG - Intronic
1064927658 10:20587138-20587160 CCACTCTATGGAGTCACACTGGG + Intergenic
1065037307 10:21652946-21652968 AAAATCTTTGGAATCATCCATGG - Intronic
1074470160 10:113719719-113719741 TCACTCTATTGAATACTCCAGGG + Intronic
1075524672 10:123173650-123173672 CAACCCTATGGAAACATGCAGGG + Intergenic
1079171615 11:18101653-18101675 CCACTCTAGGTATTCACCCAAGG + Intronic
1079293923 11:19214760-19214782 CCACACTGTTGACTCATCCATGG + Intergenic
1079508098 11:21177521-21177543 CCAAGCTATGGAAACAACCAGGG - Intronic
1082175703 11:49056495-49056517 CCCCTCTAAGGAATCATTCAAGG + Intronic
1086690038 11:89779570-89779592 TCCCTCTAAGGAATCATTCAAGG - Intergenic
1086715816 11:90060385-90060407 TCCCTCTAAGGAATCATTCAAGG + Intergenic
1089451388 11:118599881-118599903 CTGCTCTTTGGAATCATTCAAGG - Intronic
1094213505 12:27917408-27917430 CCAAGATATGGAATCATCCTCGG + Intergenic
1096061268 12:48702663-48702685 TCACTCTATGGAACAAGCCAAGG - Intronic
1096418836 12:51438539-51438561 CCAAGATATGGAATCATCCTAGG - Intronic
1097825949 12:64174827-64174849 CCACTCTGTGGGATCATCAATGG - Intergenic
1098388719 12:69946665-69946687 CCCCTTTATGCAATCACCCAAGG + Intronic
1100478510 12:94955925-94955947 CCACTGTAAGGAAATATCCAGGG - Intronic
1102654147 12:114466266-114466288 CCACTTTATTGAATCAGCCTCGG - Intergenic
1109432758 13:62257029-62257051 CCATTCTATGGAATATTCTAAGG - Intergenic
1112724477 13:102286821-102286843 CCACACTATGGACTAATCCCTGG + Intronic
1116436576 14:44901284-44901306 ACACACTATGAAATCATCTAAGG + Intronic
1116983306 14:51193982-51194004 GCTCTCTCTAGAATCATCCATGG - Intergenic
1121629020 14:95409133-95409155 CCACTCTATGGAATGTTCCCTGG - Intronic
1121926706 14:97933531-97933553 CCTCTCTTTGCAATCTTCCAAGG + Intronic
1126864116 15:52919094-52919116 CCAGTATATGGAATCAACCTAGG + Intergenic
1127160689 15:56181725-56181747 CTACTCTATGGGATTATCTAAGG + Intronic
1129896407 15:79110884-79110906 CCATACTATGGAATCATACTTGG + Intergenic
1130552307 15:84898045-84898067 CCAAACTATGGAATCAACCTAGG - Intronic
1140582474 16:76247984-76248006 CCAAGATATGGAATCAACCAAGG + Intergenic
1141045878 16:80715800-80715822 CCACTCTATGGAATCATCCATGG + Intronic
1144888214 17:18478090-18478112 CCACCCTATGGAAGCCCCCAAGG + Intronic
1145143992 17:20466213-20466235 CCACCCTATGGAAGCCCCCAAGG - Intronic
1146438177 17:32870917-32870939 CCAACCTATGGAATCCTCAAAGG - Intronic
1148853840 17:50567851-50567873 CCACTGTATGGAAAGACCCAGGG + Intronic
1150153142 17:62827288-62827310 TCACTCTATGTACTTATCCAAGG - Intergenic
1151248504 17:72815204-72815226 GCTGTCTATGGAATCACCCAGGG + Intronic
1154016064 18:10618907-10618929 CCACTAAATGGAATGAGCCACGG + Intergenic
1154189449 18:12216737-12216759 CCACTAAATGGAATGAGCCACGG - Intergenic
1154309575 18:13256682-13256704 GCTCTCTATGGAAACATCCATGG - Intronic
926751733 2:16203773-16203795 CTTCTCTGTGGAATCATCCCTGG + Intergenic
929886133 2:45880277-45880299 CCAAGATATGGAATCAACCAAGG - Intronic
932459308 2:71872242-71872264 CCCCTCCATGGAATCATCCCTGG - Intergenic
932949200 2:76272804-76272826 TCAATCTAAGGAATCATCAACGG - Intergenic
935573042 2:104682281-104682303 ACACTCTATGGTTTCATCCGTGG - Intergenic
936490632 2:112969024-112969046 CTACTCAATGTAACCATCCAAGG - Intergenic
943747072 2:191473044-191473066 TAAATCTATGAAATCATCCAGGG - Intergenic
944168060 2:196743735-196743757 CCAATCTATGGAAGAATTCAAGG - Intronic
944938800 2:204599599-204599621 CCAAGATATGGAATCATCCTAGG - Intronic
947213719 2:227730920-227730942 CCTCTCTTTGGAAGCATCCGTGG - Intergenic
1173673917 20:44817486-44817508 CCACTCTATGGGTTCAGACAGGG - Intergenic
1174830808 20:53810670-53810692 CCTCTCCCTGGAATCATCTAGGG - Intergenic
1182837545 22:33356351-33356373 CCATTCTCTGGCATGATCCAAGG + Intronic
1183423419 22:37725213-37725235 CCACTCAATGGAACAATCCCAGG + Exonic
1183998407 22:41653730-41653752 CCATACTTTGGAATCATCCATGG + Intronic
950443724 3:13024230-13024252 CCTCTCCAATGAATCATCCATGG + Intronic
950607712 3:14097836-14097858 CCAATATATGGAATCATCCTAGG - Intergenic
957869271 3:86067066-86067088 CCACTCAATATAATGATCCAAGG - Intronic
962300484 3:134237763-134237785 TTACTCTATGATATCATCCATGG + Intronic
964490580 3:157231527-157231549 CCACACGATTGAATCATGCAGGG + Intergenic
971892665 4:32544718-32544740 CCAGTCTTTGGAAGCAGCCATGG + Intergenic
975022168 4:69502938-69502960 TCACTCAATGCAATCATCCCAGG - Intronic
975083292 4:70306442-70306464 CCACTCTCTGTTATCATCAAAGG - Intergenic
975915596 4:79321967-79321989 CTACTCCATGGTATCATTCAGGG - Intronic
976605225 4:86976342-86976364 CCGCATTATGGAATCAACCATGG + Intronic
977887050 4:102264220-102264242 CTACTCCATGGACTGATCCATGG + Intronic
980194508 4:129571353-129571375 CTACTCTTTGGAGTCATACAGGG + Intergenic
983886842 4:172989156-172989178 CCAACCTATGAAATCAACCAAGG + Intronic
987221668 5:15796718-15796740 CCTCTCTTTGGCACCATCCAGGG + Intronic
988294514 5:29337881-29337903 TGACTCGATGGAGTCATCCAAGG - Intergenic
991764287 5:69958109-69958131 ACACCATATGGAATCCTCCAAGG - Intergenic
991783040 5:70160038-70160060 ACACCATATGGAATCCTCCAAGG + Intergenic
991843519 5:70833181-70833203 ACACCATATGGAATCCTCCAAGG - Intergenic
991875482 5:71160365-71160387 ACACCATATGGAATCCTCCAAGG + Intergenic
995843150 5:116464584-116464606 CCCCTCTGTGGAATGTTCCAAGG - Intronic
996836982 5:127804306-127804328 CCACTATGTGCAATCTTCCAGGG + Intergenic
997205560 5:132047102-132047124 CCTCTCCATGGAAACCTCCAGGG + Intergenic
998133258 5:139661655-139661677 CCACTCTATGGCATCATCTAGGG - Intronic
1000792949 5:165629573-165629595 CCACTCTATGCAAACATCTCTGG - Intergenic
1001438700 5:171721129-171721151 CCAATCTCTGGAACCATCAAGGG - Intergenic
1007377143 6:41464604-41464626 CCACACTCTGGAATCATCCCTGG + Intergenic
1012684904 6:102234479-102234501 ACACTCTATGTCATCATTCAGGG + Intergenic
1016437126 6:144048532-144048554 ACACTATATGGAAGCCTCCAAGG + Intronic
1016571524 6:145518848-145518870 CCATTCTATGGAAACATATATGG + Intronic
1017317255 6:153045920-153045942 CCAAGATATGGAATCAACCAAGG + Intronic
1018796997 6:167193801-167193823 ACCCTCTATGGTATCCTCCAGGG - Intronic
1018819343 6:167361287-167361309 ACCCTCTATGGTATCCTCCAGGG + Intronic
1019118452 6:169784508-169784530 TCTCTCTGTGGAAGCATCCAAGG + Intergenic
1022634382 7:32118354-32118376 CCTCTCTACTGAATCATGCAAGG - Intronic
1024589786 7:50871383-50871405 CCTCTCTATGGAGACATACAAGG - Intergenic
1025933227 7:66012999-66013021 CCACTCTCTGAAAGCAGCCAGGG + Intergenic
1026458520 7:70593852-70593874 CCTCTCTATAGAATCATTCTGGG - Intronic
1027740891 7:82003126-82003148 CCACTAAATGGAATCATAAATGG + Intronic
1033560732 7:142527971-142527993 CTACTTTATGGCATCATCTATGG + Intergenic
1038258529 8:25972543-25972565 ACAGTCTATGAAATAATCCAAGG - Intronic
1042783677 8:72522552-72522574 CCAAAATATGGAATCATCCTAGG + Intergenic
1048345922 8:133574380-133574402 TCTCACTATGGAGTCATCCAGGG - Intergenic
1049572826 8:143377671-143377693 CCACTCTATGGGATCAGCCCCGG - Intronic
1057927651 9:99167423-99167445 CCACACAATGGAATGATCCTGGG + Intergenic
1058529686 9:105893454-105893476 ACACTCTAGGGAATCATCTCAGG - Intergenic
1059728489 9:117032461-117032483 CTGCTCTATGAAATCATCCCAGG - Intronic
1059848627 9:118310880-118310902 CCATTCTCTGCAATCGTCCATGG + Intergenic
1061401847 9:130372890-130372912 CCACCCTATGGAAACAGGCATGG + Intronic
1191735087 X:64380476-64380498 CTACACAATGGAATCACCCATGG - Intronic
1191975798 X:66869476-66869498 CCACTTTATGTAATCTGCCATGG + Intergenic
1197999117 X:132413501-132413523 CCTCTCCATGGAATCAGCCCAGG + Intronic
1199972146 X:152869055-152869077 CCTCTCCATAGCATCATCCATGG - Exonic