ID: 1141046701

View in Genome Browser
Species Human (GRCh38)
Location 16:80721914-80721936
Sequence TTCCAGGCACAGCGACGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141046692_1141046701 22 Left 1141046692 16:80721869-80721891 CCCCAAACTCACTGAACCTGCTG 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1141046701 16:80721914-80721936 TTCCAGGCACAGCGACGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1141046691_1141046701 27 Left 1141046691 16:80721864-80721886 CCTCTCCCCAAACTCACTGAACC No data
Right 1141046701 16:80721914-80721936 TTCCAGGCACAGCGACGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1141046698_1141046701 6 Left 1141046698 16:80721885-80721907 CCTGCTGGGCTGCAAATTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 164
Right 1141046701 16:80721914-80721936 TTCCAGGCACAGCGACGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1141046690_1141046701 30 Left 1141046690 16:80721861-80721883 CCACCTCTCCCCAAACTCACTGA 0: 1
1: 0
2: 2
3: 34
4: 441
Right 1141046701 16:80721914-80721936 TTCCAGGCACAGCGACGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1141046693_1141046701 21 Left 1141046693 16:80721870-80721892 CCCAAACTCACTGAACCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 158
Right 1141046701 16:80721914-80721936 TTCCAGGCACAGCGACGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1141046695_1141046701 20 Left 1141046695 16:80721871-80721893 CCAAACTCACTGAACCTGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1141046701 16:80721914-80721936 TTCCAGGCACAGCGACGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141046701 Original CRISPR TTCCAGGCACAGCGACGAAG AGG Intronic
900395620 1:2452124-2452146 TTCCAGGCTCAGCAATGCAGTGG - Intronic
901659301 1:10788725-10788747 TTCCAGGCAAAGCAAGGATGAGG - Intronic
906511184 1:46411228-46411250 TTCCAGCCCCAGCCACTAAGGGG - Intronic
907185511 1:52606140-52606162 TGCCAGGCCCAGAGATGAAGTGG + Intronic
908030135 1:59990284-59990306 TTCCAGGCACTGTGGGGAAGTGG + Intronic
910434516 1:87191621-87191643 TTCCAGGCACAGTGACAGGGAGG + Intergenic
916506668 1:165434488-165434510 TTCCTGGCACAGCAGCAAAGGGG - Intronic
922196791 1:223365310-223365332 TTCCAGCCACAGTGATTAAGAGG + Intergenic
1064148077 10:12841292-12841314 TTCCAGGCACCACCACTAAGTGG + Intergenic
1064167057 10:12995712-12995734 TTCCAGGCTCAGAGAAAAAGTGG - Intronic
1070440884 10:76441948-76441970 TTCCAGGCAGAGAGACGAGGTGG - Intronic
1070469163 10:76760791-76760813 TTCCAGGCACAGAAAGGGAGAGG - Intergenic
1075469860 10:122680002-122680024 TTTCAGGCACATCGCTGAAGTGG + Intergenic
1076539855 10:131207022-131207044 TTCCAGGCTCAGCTCTGAAGAGG - Intronic
1083234733 11:61344130-61344152 TTCTAGGCTCAGCCTCGAAGCGG + Exonic
1083760044 11:64810629-64810651 TTCCAGGCTCAGCGGGGCAGGGG - Intronic
1090502302 11:127273295-127273317 GTCCAGGCACGGAGAGGAAGAGG + Intergenic
1091445278 12:541559-541581 TCCCAGGCCCAGGGAGGAAGAGG + Intronic
1092007681 12:5083375-5083397 TTCCGGGCACAGAGGAGAAGTGG - Intergenic
1093272067 12:17075868-17075890 TTCCAGGCACAGATAGGCAGAGG - Intergenic
1093885570 12:24455995-24456017 TACCAGGCAGAGGGAGGAAGTGG - Intergenic
1095256378 12:40041404-40041426 TTCCAGGTACAGTGAGGGAGAGG - Intronic
1095440621 12:42235981-42236003 TTGCAGGGACAGCAAGGAAGGGG - Intronic
1095529631 12:43171312-43171334 TCCCAGGCACTCCCACGAAGGGG + Intergenic
1098076426 12:66737006-66737028 TTTCAGGTACAGCTGCGAAGCGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1099663816 12:85600000-85600022 TTTCAGGCACAGAGTAGAAGTGG - Intergenic
1099993203 12:89749221-89749243 TTACAGGCAGAGCGAACAAGTGG - Intergenic
1101725844 12:107387574-107387596 TTCCAGGTACTGCAAAGAAGAGG + Intronic
1101838799 12:108313138-108313160 TCCCAGGCACAGGGAAGGAGGGG + Intronic
1104150332 12:126075835-126075857 TTCCAGGCACTGTGAAGAGGAGG - Intergenic
1107300831 13:38964098-38964120 CTCCAGGCCCAGCAACAAAGGGG + Intergenic
1112294082 13:98171204-98171226 CGCCAGGCACAATGACGAAGAGG - Intronic
1113883948 13:113647567-113647589 TGCCAGGCACAGAAATGAAGTGG - Intergenic
1116962970 14:50985909-50985931 TTCAAGGCACAGAGATCAAGGGG + Intronic
1116986721 14:51227778-51227800 TTCCAGGCACAGAGAAGAGCAGG + Intergenic
1118734502 14:68691773-68691795 TGCCAGGCACAGAGACCAGGAGG - Intronic
1121788885 14:96683895-96683917 TTCCAGGCACTGATAGGAAGGGG + Intergenic
1122057904 14:99117598-99117620 TCCCAGGCACAGGCAAGAAGGGG - Intergenic
1123480411 15:20625909-20625931 TTCCAGGCACAGTGCTGAAGTGG - Intergenic
1123637597 15:22374456-22374478 TTCCAGGCACAGTGCTGAAGTGG + Intergenic
1126467736 15:48976127-48976149 CTCCAGGCACAGCGACTCGGGGG + Intergenic
1128425445 15:67537977-67537999 TTCAAGGCACAGTGAGGAGGAGG + Intergenic
1131064079 15:89422152-89422174 TTCCAGGGACAGGGAGAAAGAGG - Intergenic
1131687496 15:94786098-94786120 TTCCAGGCACAGCACTGATGAGG + Intergenic
1135193607 16:20376051-20376073 TTCCAGGTACTGGGACCAAGAGG - Exonic
1136477158 16:30520568-30520590 TCCCAGGCACAGGGACACAGAGG + Intronic
1141046701 16:80721914-80721936 TTCCAGGCACAGCGACGAAGAGG + Intronic
1143450698 17:7035333-7035355 TTCCAGCCCCAGTGAGGAAGAGG + Intergenic
1144386906 17:14756387-14756409 TACTAGGCACAGAGACCAAGAGG - Intergenic
1146307186 17:31739357-31739379 TTCCAGGCACATGGAAGAAGAGG - Intergenic
1147048287 17:37771114-37771136 TCCCAGGCACAGCCACAAGGCGG - Intergenic
1152922668 17:83073679-83073701 ATCCAGGCGCAGCGTCGATGTGG + Intergenic
1157157382 18:45281026-45281048 TTCAAGGGACAGCGCCAAAGAGG - Intronic
1161477399 19:4494160-4494182 CTCCAGTGACAGCGACGAGGTGG + Exonic
1161768321 19:6218646-6218668 TTCCAGGCTCAGCCACCAGGGGG + Intronic
1166347246 19:42174424-42174446 TTCCACGCACAGAGCCAAAGAGG + Intronic
1167041469 19:47025182-47025204 CTCCAGGCTCAGCAACCAAGAGG - Intronic
925380355 2:3420625-3420647 TTCCAGCCACAGCGGCGGTGTGG - Intronic
929712510 2:44279343-44279365 TTCCAGGCACAGCAAAGGAAAGG - Intronic
929807164 2:45156406-45156428 TTCCAGGCCCTGAGACAAAGTGG - Intergenic
931920685 2:67012174-67012196 TTGCAGGCACAGCTGCCAAGAGG - Intergenic
932291455 2:70583527-70583549 ATCCAGGCACAGTGAGGACGTGG + Intergenic
934232713 2:90199971-90199993 TTCCAGGCACTGCGAGAGAGAGG + Intergenic
936987923 2:118329293-118329315 TTCAAGGCACAGCCAGGAACTGG - Intergenic
940572505 2:155456381-155456403 TTGCAGGCACAGGGAGGAAATGG - Intergenic
942874738 2:180781717-180781739 CTCCAGGCACAGCCAAGAGGAGG - Intergenic
949009494 2:241670489-241670511 ATCAAGGCACAGCAACGCAGTGG + Intronic
1170581568 20:17703341-17703363 TTCCAGGCACAGAGATGGAGTGG - Intronic
1177839571 21:26220644-26220666 TTCCAGCCACAGAAACTAAGAGG + Intergenic
1179461169 21:41536260-41536282 TGGCAGGAACAGCGAGGAAGTGG + Intergenic
1182667582 22:31970807-31970829 TTCCAGGCGCAGCCTCGAGGTGG + Intergenic
1184584043 22:45435714-45435736 TTCCAGGCATATAAACGAAGTGG - Intergenic
1184925421 22:47633081-47633103 TTCCAGGGGAAGTGACGAAGGGG + Intergenic
950404838 3:12797765-12797787 GTTCAGTCACAGCGAGGAAGTGG + Intronic
953417683 3:42732301-42732323 TTCCAGGCAAAGCCTCCAAGTGG - Intronic
954924510 3:54220665-54220687 TTCCTGGGACAGGGACGATGGGG - Intronic
964761043 3:160135353-160135375 TTACAGGCACATTGAAGAAGTGG + Intergenic
967842899 3:194021171-194021193 TTCCAGGGGCAGCTAGGAAGAGG + Intergenic
969592050 4:8127615-8127637 TGCCAGGCCCAGCCACGCAGAGG - Intronic
969742139 4:9036689-9036711 ATCCAGACACAGCAAGGAAGAGG + Intergenic
975321395 4:73012605-73012627 TTGCAGGCAAAGAGAAGAAGAGG + Intergenic
978429516 4:108619217-108619239 TGCCTGGCACAGAGACGAAAAGG + Intergenic
978611441 4:110545511-110545533 TTCCAAGCAGAGAAACGAAGAGG - Intronic
996307785 5:122069689-122069711 TTTCAGGGACTGCGAGGAAGGGG + Intronic
1001603603 5:172944802-172944824 CTCCAGGCACAGCAACTTAGTGG + Intronic
1002566616 5:180115837-180115859 ATCCCGGCACAGTGAGGAAGAGG - Intronic
1004759371 6:18649043-18649065 TTTCAGGCACAGTGATGTAGTGG - Intergenic
1005388309 6:25308297-25308319 TCTCAGGCACAGTGACAAAGGGG - Intronic
1006903756 6:37519460-37519482 TTCCAGGAATAGGGAAGAAGGGG + Intergenic
1007733524 6:43966175-43966197 GTCCAGGCACAGGGCTGAAGGGG - Intergenic
1007914424 6:45547682-45547704 TTCAAAGCACAGAGAGGAAGCGG - Exonic
1009784677 6:68319561-68319583 TTCCAGGCTCATCGAAGCAGAGG + Intergenic
1022392554 7:29956199-29956221 GTCCAGGCAAAGGGAGGAAGAGG + Intronic
1029267797 7:99355913-99355935 TTCCAGCCACAGCAGAGAAGTGG - Intronic
1036247335 8:7129240-7129262 ATCCAGACACAGCAAGGAAGAGG + Intergenic
1036886926 8:12564722-12564744 ATCCAGACACAGCAAGGAAGAGG - Intergenic
1037436398 8:18868053-18868075 TTCCAGGATCAGCGAACAAGAGG - Exonic
1038138818 8:24820831-24820853 TTCCAGGAACAGCGGCCATGTGG + Intergenic
1039805007 8:40990283-40990305 TTCCAGGCAGAGGGAGCAAGAGG + Intergenic
1049435336 8:142583781-142583803 GGCCAGGCACAGGGACCAAGGGG + Intergenic
1059692096 9:116695504-116695526 CTCCAGGCATAGAGAAGAAGGGG - Intronic
1060033088 9:120232403-120232425 TTCCAGGCAGAGGGACTAACAGG + Intergenic
1060765288 9:126291166-126291188 TTCAAGCCACAGGGACGACGGGG - Intergenic
1061767493 9:132890697-132890719 TTCCAGACACAGCCAGGCAGAGG + Intergenic
1193281695 X:79658380-79658402 TTGCAGGCACATGGATGAAGCGG - Intergenic
1198508792 X:137328206-137328228 TTCCAGCCACATAGATGAAGAGG - Intergenic
1199719824 X:150535021-150535043 TTCCAGGCAGAGAGACCAACAGG - Intergenic
1200836023 Y:7732284-7732306 TTCCAGTCCCAGTGAGGAAGGGG - Intergenic