ID: 1141047998

View in Genome Browser
Species Human (GRCh38)
Location 16:80734542-80734564
Sequence ATAGGGAAGCAGGTTTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 363}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141047998 Original CRISPR ATAGGGAAGCAGGTTTGGGA AGG Intronic
900658540 1:3772096-3772118 GAAGGGAAGCAGGTGTGGGTGGG - Intergenic
900905230 1:5552420-5552442 ACAGGGAGGCAGGGATGGGATGG + Intergenic
901335124 1:8442687-8442709 ATATGGAAGCAGCTTTGCAACGG + Intronic
901686259 1:10945272-10945294 ATCTGGACGCAGGTGTGGGAGGG + Intergenic
901714468 1:11142094-11142116 ATAGAGAGTCAGGTTGGGGACGG + Intronic
903362774 1:22787339-22787361 TTAGGGAGGCAGTTTTGGTATGG + Intronic
904258874 1:29275649-29275671 ATAGGGCAGCAGGTTCTTGATGG - Exonic
904994883 1:34623829-34623851 AGAGGGAACCAGGTCTGGAAGGG + Intergenic
905010419 1:34743226-34743248 ATTGGGAAGGAGGTTTGGCAGGG - Intronic
905011152 1:34747914-34747936 TGGGGGAAGCAGGTCTGGGAGGG - Intronic
905172583 1:36118013-36118035 ATGGGGAAGCAGCTTTAGGTAGG - Intronic
905652640 1:39666779-39666801 AGAAGGGATCAGGTTTGGGAGGG - Intronic
905656023 1:39686619-39686641 GCTGAGAAGCAGGTTTGGGAAGG + Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
907165975 1:52411700-52411722 AAAGGGAAGCAGGATGGTGAAGG - Intronic
907684231 1:56594356-56594378 AGAGTGAAGCAGGTCTGGGGAGG + Intronic
907934032 1:59026085-59026107 ACAGGAGAGCAGGTTTGAGATGG + Intergenic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
908322148 1:62988712-62988734 ATAGGGAAGTTGGTTTGATATGG - Intergenic
909494113 1:76259024-76259046 ATAGGGAAACAGAATTGAGAAGG - Intronic
909647564 1:77934611-77934633 AGAGGGAAGAAGGTTAGGCAGGG - Intronic
909699104 1:78500595-78500617 AGAAGGAAGCAGGATTGGGTAGG - Intronic
909970962 1:81989173-81989195 ATAGGAAAAGAGGTTTAGGAGGG - Intronic
911244306 1:95499958-95499980 AAAGGGAAGCAGGTTTAAGAGGG - Intergenic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
912971138 1:114284647-114284669 GCAGGGCAGCAGGTGTGGGAAGG - Intergenic
915086219 1:153390721-153390743 ATAGGGATACACGTGTGGGAAGG + Intronic
915097185 1:153471404-153471426 ATAGGGAAGTGGGTGTGGGATGG - Intergenic
915117560 1:153610297-153610319 TTAGGGAACAAGGATTGGGATGG - Intronic
915507759 1:156368278-156368300 ACAGGGAAGCAGGCTGGGCAGGG - Intergenic
915525525 1:156473788-156473810 AGAGGGAAGAAGGTTAGAGAGGG - Intronic
915973511 1:160370474-160370496 GTGGGAAAGCAGGTTTGAGATGG - Intronic
918103307 1:181395319-181395341 ATTGTGAAGCAGGCTTGGGTGGG + Intergenic
919286926 1:195575593-195575615 AGAGGGAAACAAGTTTGGGGAGG - Intergenic
919355968 1:196522147-196522169 AAATGAAAGCAGGTTTGGAATGG - Intronic
919744464 1:200999978-201000000 ACAGGGAAGCTGGATTAGGAAGG + Intronic
920177773 1:204113856-204113878 ATAGGGGAGCAGGTAGGGGCTGG - Intronic
920612712 1:207457082-207457104 ATAAGGAAGAAGGTTTTAGATGG - Intronic
920944139 1:210512334-210512356 AAAGGGAAGCAGGTGAGGGGGGG - Intronic
921543636 1:216448956-216448978 ATAGGTTAGAAGATTTGGGAAGG - Intergenic
922398446 1:225226455-225226477 ACAGGGAGGAATGTTTGGGAAGG - Intronic
923078250 1:230629421-230629443 ACAGGGAAGCAGCTCTAGGATGG - Intergenic
923484636 1:234416971-234416993 AGAGGGAAGCAAGTATGTGAAGG + Intronic
923536002 1:234852293-234852315 TTGGGGAAGCTGGTCTGGGAAGG - Intergenic
923728757 1:236530630-236530652 AGAGGAAAGCTGGTTTGGGAAGG - Intronic
923760979 1:236843823-236843845 ACTGAGAAGCAGGTTTGGGATGG + Intronic
923861756 1:237898712-237898734 ATAGGGGAGCTGGTTTTGCAAGG + Intergenic
924207112 1:241724980-241725002 ATAGGGAGGCAGGCTGAGGAAGG - Intronic
924290555 1:242532086-242532108 ATATGCAAGCTGGTTTGGGAAGG + Intergenic
924442244 1:244096091-244096113 ATTGGGAAGTAGGTTAGGGTTGG - Intergenic
924453882 1:244202331-244202353 ATAGGGAAGAAGGGAAGGGAAGG + Intergenic
1063242582 10:4186666-4186688 TTAGTGGAGCAGGTTTGAGATGG - Intergenic
1064503901 10:16008732-16008754 ATGGGGTAGGAGGCTTGGGAAGG + Intergenic
1065241568 10:23710134-23710156 ATAGAGTGGCAGGTGTGGGACGG + Intronic
1065293217 10:24251639-24251661 TAAGGGAGGCAGGTGTGGGATGG - Intronic
1065714721 10:28555039-28555061 TGAGAAAAGCAGGTTTGGGAGGG - Intronic
1065815776 10:29481275-29481297 ATGGGGAAGGGGGTGTGGGAAGG + Intronic
1065957150 10:30703957-30703979 ATGGGGAAGGGGGTGTGGGAAGG - Intergenic
1067691306 10:48504047-48504069 ATGGGGAAGGAGGGATGGGAAGG + Intronic
1068754084 10:60631114-60631136 AGAGGTGAACAGGTTTGGGATGG + Intronic
1068829125 10:61472906-61472928 ATAGGGAGGTAGGTTGGAGAGGG + Intergenic
1068963292 10:62886797-62886819 ATAGGCAGGCAGGTTTGAGATGG - Intronic
1070804917 10:79265272-79265294 ACAGGGAAGCAGGTAGGGCAGGG + Intronic
1071197568 10:83178864-83178886 TTAGGGCAGCAGTTTTGGGGTGG - Intergenic
1072009045 10:91287651-91287673 AGAGGGAAGCATGTTTGCAAGGG - Intergenic
1072436209 10:95416573-95416595 TGAGGGAAGGAGGTTTGAGAGGG - Intronic
1072712224 10:97723272-97723294 AAAGGGAAGTAGCTTTAGGAAGG + Intergenic
1072729902 10:97838837-97838859 AGTGGGAAGGAGGATTGGGAAGG + Intergenic
1072808804 10:98444236-98444258 GTGGGGAAGGAGATTTGGGAGGG - Intronic
1073007936 10:100339044-100339066 ATAGGGTAGGAAGATTGGGAGGG + Intergenic
1074010089 10:109469477-109469499 ATAGGGAAGCATGTTTATGGAGG + Intergenic
1074616982 10:115079359-115079381 TGGGAGAAGCAGGTTTGGGAGGG - Intergenic
1074811241 10:117107238-117107260 ATGAGGAAACAGTTTTGGGACGG + Intronic
1074876323 10:117616166-117616188 AGTGGGATGGAGGTTTGGGATGG + Intergenic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1077443276 11:2578547-2578569 AGAGGGGAGCAGGCCTGGGAGGG + Intronic
1077601112 11:3575627-3575649 CTAGGAAGGCAGGTTTGGGCTGG - Intergenic
1077664032 11:4092540-4092562 AGAGGGAGGCAGGTGTGGGTGGG - Exonic
1078143008 11:8705204-8705226 CTAGGGAAGCTTGTTAGGGATGG - Intronic
1078880914 11:15447997-15448019 ATAGATAAGCAGGGTTGGGCGGG - Intergenic
1079357926 11:19745471-19745493 GTAGGGAAGCAGGTGTGTGGAGG - Intronic
1079367126 11:19819279-19819301 GTAGGCAAGCAGGTTGGGAATGG + Intronic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079759706 11:24313219-24313241 ATAAGGAAGCAAGTATGAGAAGG - Intergenic
1080455071 11:32411173-32411195 ATAGGAAAGAAAGGTTGGGATGG - Intronic
1080720331 11:34842194-34842216 CTTGGGAACCAGGTTTGGGAAGG - Intergenic
1081111444 11:39138725-39138747 GAAGGGGAGCAAGTTTGGGAAGG - Intergenic
1081605996 11:44527291-44527313 AGAAGGCAGCAGGGTTGGGATGG - Intergenic
1082939674 11:58691153-58691175 GTTGGGGAGCAGCTTTGGGAGGG - Intronic
1082946939 11:58771020-58771042 AAAGGAAAACTGGTTTGGGACGG + Intergenic
1083208823 11:61169963-61169985 GCAGGGAAGCAGGACTGGGAAGG + Intergenic
1083229582 11:61307761-61307783 ATAGTGCAGCAGGTTTGGAGTGG - Intronic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084257030 11:67950201-67950223 CTAGGAAGGCAGGTTTGGGCTGG - Intergenic
1084468450 11:69341047-69341069 TTTGGGATGCAGATTTGGGATGG + Intronic
1084815749 11:71645067-71645089 CTAGGAAGGCAGGTTTGGGCTGG + Intergenic
1084993701 11:72954642-72954664 AAAGAGTAGCAAGTTTGGGAGGG + Intronic
1085511110 11:77088602-77088624 AGTGGGAAACAGGTCTGGGAAGG - Intronic
1086573961 11:88316862-88316884 ATAGGGAAGCAGCTTTGGAGAGG - Intronic
1087875119 11:103345860-103345882 AAATGGTAGCAGGTTTGGGGAGG + Intronic
1087929587 11:103961476-103961498 ATAGGGAAGCAGGCAGGTGAAGG + Intronic
1088520043 11:110687459-110687481 ATAGGGAGGCAGTGTGGGGAAGG + Intronic
1089112284 11:116066309-116066331 ATAGTCAAGCAGGTTGGGTAAGG - Intergenic
1089813087 11:121147693-121147715 ATGGGGAAGCTGTTTTGGAAGGG + Intronic
1090331067 11:125932569-125932591 AAGGGGAAGCAGGCTTGGGCTGG - Intergenic
1091762619 12:3097209-3097231 AGACGGAAGCAGGCATGGGAGGG - Intronic
1092427262 12:8384985-8385007 CTAGGAAGGCAGGTTTGGGCTGG - Intergenic
1092857186 12:12685204-12685226 ACAGGGAGGTAGGTATGGGATGG - Intronic
1095302162 12:40597509-40597531 ATAGGTAAGGTGGTTTGGAATGG + Intergenic
1096171836 12:49477790-49477812 ATAGGGAATCAAGTTTGGAAGGG - Intronic
1098276479 12:68817179-68817201 ATGGGGAAGCAGGTTTAAAAAGG - Intronic
1099315792 12:81080569-81080591 TTGGGCAAGCAGGGTTGGGAGGG + Intronic
1101241114 12:102841100-102841122 ATGAGGAAACAGGCTTGGGAAGG + Intronic
1104567721 12:129900353-129900375 ATATGGAAGCAGTTTCAGGAAGG + Intronic
1104857926 12:131910490-131910512 ATGGTGCAGCAGGCTTGGGATGG + Intronic
1104949001 12:132430379-132430401 ACAGAGAGGCAGGTCTGGGAAGG + Intergenic
1105251545 13:18703153-18703175 TTAGGGAAGAAGGTTAGGGCAGG - Intergenic
1107328283 13:39268982-39269004 GAAGGGAAGCAAGTTTAGGATGG + Intergenic
1114196280 14:20479383-20479405 GAAGGGAAGTAGGTGTGGGAGGG + Intergenic
1114719407 14:24864463-24864485 CTAAGGAAGCAGGTGAGGGAAGG + Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1116737260 14:48707809-48707831 ATAGGGACGCAGACTTGGAAAGG - Intergenic
1117660291 14:57997392-57997414 ATAGGAAGACTGGTTTGGGAAGG - Intergenic
1120935806 14:89893693-89893715 AAAAGGAAGCAGGATTGGGCAGG - Intronic
1121231379 14:92361343-92361365 GTAGAGAAGCAAGGTTGGGAAGG + Intronic
1123662472 15:22576202-22576224 ACAGGCAAGCAGGTTTGGGTGGG + Intergenic
1124261816 15:28199702-28199724 ACAGGCAAGCAGGGTTGGGTGGG - Intronic
1124316272 15:28670486-28670508 ACAGGCAAGCAGGTTTGGGTGGG + Intergenic
1125979155 15:43984302-43984324 ATGGGGATGCGGGTTTGGGTAGG - Intronic
1126315261 15:47362973-47362995 AAAGGGCAGCAGTGTTGGGAAGG - Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126407047 15:48332039-48332061 CTCGGAAAGCAGGTTTGGGATGG - Intronic
1126451027 15:48809943-48809965 ATGGGGGAACAGGCTTGGGAGGG - Intronic
1126684204 15:51233181-51233203 ATAGGGAAGGAGGATGGGGGAGG - Intronic
1127957240 15:63864032-63864054 AAAGAGAAGCTGGTTTGGAAGGG + Intergenic
1128138536 15:65282372-65282394 AAAGGGAATCAGGTCTGGAATGG - Intronic
1128652706 15:69430861-69430883 ATGAGGAAATAGGTTTGGGAAGG + Intronic
1128657257 15:69471510-69471532 ATTGGGAAGCAGGTGAGGCACGG + Intergenic
1128709975 15:69864409-69864431 ATCGGGAATTAGGTTTGGGAGGG + Intergenic
1128795754 15:70465388-70465410 AATGGGAAGCAGGTTTGGGCAGG - Intergenic
1129121688 15:73401267-73401289 ATAGGGAAGGGGGTTAGGGGAGG + Intergenic
1129453048 15:75661355-75661377 GTGGGGAAGCAGGTTAGGGTGGG - Exonic
1130147725 15:81287267-81287289 AAAAGGTAGCAGGCTTGGGAGGG + Intronic
1130831627 15:87607108-87607130 AGAGGGAAGCAGGCATGTGAGGG + Intergenic
1132567706 16:630922-630944 AGAGGGGAGGAGGTTGGGGAGGG - Exonic
1133198501 16:4187726-4187748 AGAGGGACGCAGGGTTGGGTGGG + Intergenic
1133370986 16:5245386-5245408 CTAGGAAGGCAGGTTTGGGCTGG + Intergenic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1135420923 16:22305036-22305058 TCAGGGAAGCAGTTTGGGGAAGG - Intronic
1137444903 16:48525796-48525818 AGAGGGAAGCAGTTTGGGGTGGG - Intergenic
1137672978 16:50290312-50290334 AGTGGGAACCAGGTGTGGGAGGG + Intronic
1137731338 16:50693001-50693023 ATCGGGAAGCATGTTTGTGGTGG + Intergenic
1139101972 16:63778531-63778553 ACAGGGAATTAGGATTGGGAGGG - Intergenic
1139525980 16:67516969-67516991 AGAAGGAGGAAGGTTTGGGATGG + Intergenic
1140443333 16:75003510-75003532 GTAAGGAAACAGGTTTGGGGAGG + Intronic
1140872906 16:79123117-79123139 ATAAGGAAGAAGGTTTGGGTAGG + Intronic
1141047998 16:80734542-80734564 ATAGGGAAGCAGGTTTGGGAAGG + Intronic
1141402798 16:83765119-83765141 ATATGTAAGCAGATGTGGGATGG - Intronic
1141408165 16:83812799-83812821 CCAGGGACGCAGGTTTCGGATGG - Exonic
1141510660 16:84509811-84509833 GTAGGGAAGCAGGTGGGGGCAGG + Intronic
1141612223 16:85188088-85188110 AAGGGGAGGCAGGTGTGGGATGG + Intergenic
1143356999 17:6337753-6337775 ATGGGAAAGCAGGTTGGGCATGG + Intergenic
1143987749 17:10929793-10929815 GGAGAGAGGCAGGTTTGGGAGGG + Intergenic
1146960656 17:36973778-36973800 ATAGCCAAGCAGGCTGGGGACGG + Intronic
1146986544 17:37225444-37225466 ATTGGGAATCAGGTCTGGCAGGG + Intronic
1147359490 17:39922056-39922078 GTATGGAAGCAAGTGTGGGATGG - Intronic
1148062729 17:44847845-44847867 ATAGGGATGCAGATGGGGGAAGG + Intronic
1148648182 17:49230944-49230966 AAAGGGTAGCAGGGTGGGGATGG + Intergenic
1150057631 17:62033368-62033390 AGAGGGAAGCATGCTTAGGATGG - Intronic
1150223653 17:63511073-63511095 GAAGGGAGGGAGGTTTGGGAGGG - Intronic
1150607528 17:66707059-66707081 ATAGGGAAGGGTGTGTGGGAAGG - Intronic
1151073158 17:71240613-71240635 ATATGGGAGCAGGTTTTTGATGG - Intergenic
1154219743 18:12441517-12441539 CTAGGGAAGGGGGTTAGGGATGG + Intergenic
1155377743 18:25179397-25179419 ATAGGGAGTTAGGTTTGAGATGG + Intronic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1157556445 18:48615922-48615944 AAAAGGCTGCAGGTTTGGGATGG + Intronic
1157987512 18:52455884-52455906 ATACGGAAGTAGGGTAGGGATGG - Intronic
1159006906 18:63021455-63021477 AAATGGAAGTAAGTTTGGGATGG - Intergenic
1161143071 19:2660300-2660322 ACAGGGAATCAGGATTGGAAAGG - Intronic
1162128683 19:8512563-8512585 ATGGGGAGGCAGGTTAGGGTGGG - Intronic
1162926067 19:13930983-13931005 TTAGGGAAGCAGTTTTGGGGAGG + Intergenic
1166233824 19:41441804-41441826 GAAGGGCAGCAGGTTTAGGAAGG + Intergenic
1166300194 19:41908558-41908580 AGAGGGAGGCAGCTTGGGGAAGG + Intronic
1166348659 19:42182946-42182968 AAAGGGAAGCAGGTTAGAGAAGG + Intronic
1166476642 19:43131553-43131575 ATAGGGGAGCAGGGCTGCGATGG - Intronic
1167468428 19:49662462-49662484 AGAGGGCCCCAGGTTTGGGAAGG + Exonic
1167745990 19:51352154-51352176 TTAGGGAAGGAGGTTAGGGCTGG - Intronic
926007987 2:9387593-9387615 ATAAGAAGGCATGTTTGGGAAGG + Intronic
927183789 2:20467777-20467799 TTCGGGAAGCAGGTAAGGGAGGG - Intergenic
927670895 2:25068036-25068058 ACAGGGAAGCAGGTAAGAGATGG - Intronic
929058747 2:37901952-37901974 AGAGAGAAGGAGGTTTGGAATGG - Intergenic
929968185 2:46551112-46551134 ATAAGGAAACAGGTTTCCGAAGG - Intronic
930707817 2:54521692-54521714 ATAGTGAAGAAGGGTTGGGAGGG + Intronic
930712599 2:54563188-54563210 AGAGGGAACCAGGTTAGGGTGGG - Intronic
931147809 2:59539078-59539100 GAAGGAAAGCAGATTTGGGAAGG - Intergenic
931295753 2:60923534-60923556 AAGGAGAAGCAAGTTTGGGAGGG - Exonic
932428967 2:71662074-71662096 ATGGGGAAACAGGCATGGGAGGG - Intronic
932452894 2:71827064-71827086 TTAGGGATGCAGGACTGGGAAGG + Intergenic
934121425 2:88843923-88843945 ATAGGGAGGCAGATGAGGGAAGG - Intergenic
935232250 2:101109130-101109152 ATAGGAAACCAGGGTTGGGGTGG + Intronic
935562597 2:104574619-104574641 AAAAGGAAGCAGTTTTGGCAAGG - Intergenic
936393270 2:112096010-112096032 ATAGGGAAGGGGGTTTGGAGGGG - Intronic
936839538 2:116753533-116753555 ATGGGGAAGGAAGGTTGGGAGGG - Intergenic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
937687451 2:124713718-124713740 GTATGGAAGCTGGTTTGAGAGGG - Intronic
938679489 2:133674933-133674955 AGAGGGAAGCATGTTTGTCAGGG - Intergenic
939078437 2:137630425-137630447 ATGGGGAAGAAGTTTGGGGATGG - Intronic
939256363 2:139749172-139749194 AGAGGGAAGGGGATTTGGGAAGG - Intergenic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
942851588 2:180494308-180494330 GTAGGGAACCAGGTGTGGGCAGG + Intergenic
943055149 2:182968214-182968236 ATAGGGAAGCATGACTGGGAAGG + Intronic
944545000 2:200790407-200790429 ATAGGGAAGGCCCTTTGGGAAGG + Intergenic
945164626 2:206929817-206929839 ATAGGGATTCAGTCTTGGGAGGG - Intergenic
945827173 2:214736398-214736420 ATTGGGAAGGAGATTTGGGAAGG - Intronic
946026287 2:216673721-216673743 TGAGGGAGGCAGGTTTGGAATGG - Exonic
946162787 2:217846360-217846382 TTAGGGAAGCAGCTTGGGGCAGG - Intronic
946774639 2:223124869-223124891 TGAGGGAAGCAGGATTGGGCTGG + Intronic
947267748 2:228301748-228301770 ATAAGGAGGCATGTTTGGAAAGG + Intergenic
947389572 2:229625335-229625357 ATCGGGAAGCAGGTGTCAGAAGG - Intronic
947911190 2:233802060-233802082 CTGGGGAAGCAGGGATGGGATGG + Intronic
948327019 2:237132539-237132561 CTATGGAAGCAGTTATGGGAAGG + Intergenic
948406924 2:237728807-237728829 AGAGGGAAGAAGGTCTGGGTGGG - Intronic
948760013 2:240184512-240184534 CTAGGGAAGAAGGTAGGGGATGG - Intergenic
1168874820 20:1164277-1164299 TTAGGTAAGCAGGTGTGGCAAGG - Intronic
1169476338 20:5934327-5934349 AGTGGGAAGCAGGTTTGGTGTGG - Intergenic
1169710094 20:8551524-8551546 AAAGGGATGCAGGTATGGGATGG - Intronic
1170010127 20:11713838-11713860 ATTGGGAAGCAGATGTGGGAGGG + Intergenic
1170017567 20:11798933-11798955 ATAGGGAAGAGGGTTTGCCAAGG - Intergenic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1172384226 20:34522262-34522284 ATGGGGAAACAGGTTTGGAAAGG - Intronic
1172631022 20:36378171-36378193 GCAGAGGAGCAGGTTTGGGACGG + Intronic
1172808301 20:37629215-37629237 AGAGGGAAGCAGGAGAGGGAAGG + Intergenic
1172882119 20:38208876-38208898 AGAGGGAAGCAGGACTGGAAGGG + Intergenic
1172926387 20:38540447-38540469 ATAGGGAAGCAGGTGTTATAAGG + Intronic
1174677580 20:52373262-52373284 ATAGGTAGGCAGGTCTGGGCAGG - Intergenic
1174769106 20:53281729-53281751 GTAGGGAAGCAGGACAGGGAAGG + Intronic
1178446553 21:32648859-32648881 AGAGAGAAGTAGGTGTGGGATGG - Intronic
1178821227 21:35977064-35977086 ATGGGGAAGCAGGCTTGGGGAGG - Intronic
1180099564 21:45578221-45578243 GTGGGGAAGAAGGTTTGGCATGG + Intergenic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181373946 22:22441171-22441193 ATAGTGGAGCAGGTCTGGGTGGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181778715 22:25178090-25178112 GTCGGGCAGCAGCTTTGGGATGG + Intronic
1183425783 22:37738761-37738783 AGGGGGAAGCAGGTTGGAGATGG + Intronic
1183661408 22:39223801-39223823 TGAAGGAAGCAGGTTTTGGAAGG + Exonic
1184988983 22:48154756-48154778 AAAGGGAAGCAAGTTGGGGCTGG + Intergenic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
950629781 3:14274823-14274845 CTAGGCACGCAGGTTGGGGATGG - Intergenic
950750535 3:15124520-15124542 CTAGGAAGGCAGGTTTGGGCTGG + Intergenic
951144844 3:19214619-19214641 TAAGGGAAGCAGGATTGAGAAGG - Intronic
951638185 3:24803461-24803483 AAAAGGAAGCAGATTTAGGAGGG - Intergenic
951840925 3:27033338-27033360 ATAGGGTGTCGGGTTTGGGAAGG - Intergenic
953701251 3:45197758-45197780 AAAGAGAAGCTGGGTTGGGATGG - Intergenic
953972036 3:47355495-47355517 AGAGGAAAGCAGGTGTGCGAAGG + Intergenic
956178115 3:66493303-66493325 GAAGGGAGGCAGGTATGGGAAGG - Intronic
956674579 3:71722198-71722220 AGAAGGAAACAAGTTTGGGAAGG + Intronic
956778717 3:72587721-72587743 AGAGGGAAGCAGGACTGGGAGGG + Intergenic
957071973 3:75574680-75574702 CTAGGAAGGCAGGTTTGGGCTGG - Intergenic
958254332 3:91307930-91307952 ATAGGGATTAAAGTTTGGGAAGG + Intergenic
960956974 3:123039455-123039477 ACAGGTCAGCAAGTTTGGGATGG + Intergenic
961282174 3:125772407-125772429 CTAGGAAGGCAGGTTTGGGCTGG + Intergenic
961398962 3:126620785-126620807 ATAGGGAAGTACAATTGGGAAGG - Intronic
961536628 3:127574523-127574545 AGTGGGGAGCAGGTTTGGGGTGG - Intronic
961908101 3:130283812-130283834 ATAGTGGAGTAGGGTTGGGATGG - Intergenic
962452320 3:135530608-135530630 ATGTGGAAGCAGGATTGGAAGGG - Intergenic
962849952 3:139300975-139300997 AAAGTGAACCAGGTTGGGGAGGG + Intronic
962855755 3:139343393-139343415 ATGGGGGAGAAGGTTTGGGCAGG + Intronic
963864576 3:150346734-150346756 ATAGGGCATAAGGTTTGAGAGGG - Intergenic
964090453 3:152870038-152870060 ATAGGGAAGTAGGTTGAGAAGGG - Intergenic
964544697 3:157821036-157821058 AGAGAGAAGCAGCTTTGAGAAGG - Intergenic
964651456 3:159015993-159016015 ATAGGGCAACATGTTAGGGAAGG - Intronic
965117440 3:164510309-164510331 ATAAGGTTTCAGGTTTGGGAAGG - Intergenic
965534535 3:169811653-169811675 ATAGAAAAGCATGTTTTGGAGGG - Intronic
965668006 3:171116625-171116647 ATAAGAAAATAGGTTTGGGATGG + Intronic
966654136 3:182334062-182334084 GTAAGGAAGCAGGTTAGGTAAGG + Intergenic
969497845 4:7536089-7536111 CTAGGGACGCAGGTCAGGGAGGG + Intronic
969797592 4:9537903-9537925 CTAGGAAGGCAGGTTTGGGCTGG + Intergenic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970207292 4:13667716-13667738 ATATGGAAGCAGATTTGAAATGG - Intergenic
975126884 4:70793042-70793064 ATAGAGAAGCATGTTTTAGAAGG - Intronic
976132193 4:81896441-81896463 TTTAGGAAGCAGGTATGGGAAGG - Intronic
976359442 4:84160349-84160371 TTAGGAAAGCAGGATTGGCACGG - Intergenic
976889651 4:90031273-90031295 GTAAGGAAGAAGGTTTGGGAAGG + Intergenic
977776898 4:100931443-100931465 ATAGGGAAGCAGGATTAATAAGG + Intergenic
978340511 4:107717732-107717754 ATTGGGAAGTAGGTTGGGCACGG - Intronic
979224410 4:118267617-118267639 ATGAGGAAACAGGTTTGGAATGG + Intergenic
979282354 4:118881728-118881750 ATAGGGAAGTTGTTTTGGGTAGG + Intronic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
981786334 4:148483314-148483336 AGAGGGAAGCTGGTGTGAGAAGG - Intergenic
982337976 4:154260885-154260907 TTAGGGAAGCAGATTTTTGAGGG + Intronic
983368286 4:166824360-166824382 AAAGGGAAACAACTTTGGGATGG - Intronic
984086224 4:175314810-175314832 AAAGGCAAGGAGGTTAGGGAGGG + Intergenic
986182774 5:5409058-5409080 GTAGGAAACCAGATTTGGGAAGG - Intergenic
986412370 5:7493607-7493629 GTAGGCATGCAGCTTTGGGATGG + Intronic
987125894 5:14812416-14812438 ATCTGGAAGCAGGTTTTGCATGG + Intronic
987264385 5:16236695-16236717 ATAGGCTAGAAGGTTTGTGAAGG + Intergenic
988882750 5:35521227-35521249 AAAGTAAAGCAAGTTTGGGAAGG + Intergenic
989188462 5:38646854-38646876 TGAGGGAAGCAGGATTGGAAAGG + Intergenic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
989955536 5:50354929-50354951 CAAGGTAAGCAGGTTTAGGATGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990573539 5:57103264-57103286 AGTGGAAAGCAGGGTTGGGACGG - Intergenic
990715916 5:58636290-58636312 CTAGGGAAGCACATTTGGGCAGG - Intronic
991631181 5:68657649-68657671 ACAGTGAAGCAGGATTTGGATGG - Intergenic
993667379 5:90717224-90717246 ATAGAAAAAGAGGTTTGGGAAGG - Intronic
993752966 5:91692878-91692900 ATGTGGAAGCAGCTTTGGAACGG - Intergenic
995060346 5:107806401-107806423 GTAGGGATGGAGGTTTGGGGAGG - Intergenic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
997566972 5:134895458-134895480 AGAAGAAAGCAGGTTAGGGAGGG - Intronic
998175116 5:139896970-139896992 GTAGAGAGGCAAGTTTGGGAAGG - Intronic
998985257 5:147749920-147749942 ATGGGGAAACTGGTTTGGAATGG - Intronic
999763229 5:154718910-154718932 ATATGAAAGCTGGTGTGGGAAGG + Intronic
999775370 5:154808600-154808622 ACAGGTGAGCAGGTTTGGGTGGG + Exonic
1000750673 5:165092351-165092373 ACAGGGAAGCAGGTTTCTGCTGG + Intergenic
1002018916 5:176349312-176349334 ATAGGAAATCAGGTTTGGGCTGG - Intronic
1002056271 5:176599533-176599555 GGAGAGAAGCAGGTTGGGGAGGG + Exonic
1002094112 5:176821022-176821044 ATAAGGAAGCAAGTTTGGTTTGG - Intronic
1003080528 6:3017532-3017554 CTGGGGAAGCAGGCCTGGGAGGG - Intronic
1003404559 6:5817622-5817644 ATGGTGAAGCAGGTATTGGAGGG - Intergenic
1004313014 6:14562512-14562534 ACAGGGAAGCAGAATTGGGCAGG - Intergenic
1006020131 6:31112831-31112853 ATAGAGAAGCAGGGCTGGGGAGG - Intergenic
1006146622 6:31963379-31963401 AGAGGGAAGCAGGTCAGGGGTGG - Intronic
1006598235 6:35209066-35209088 GAAGGGAAACAAGTTTGGGAGGG + Intergenic
1006817684 6:36863970-36863992 TCAGGGAACCAGGTTTGGAAGGG - Intronic
1007000366 6:38306346-38306368 ATAGGGATGTAGGTGAGGGATGG - Intronic
1007942891 6:45798818-45798840 ATACGGAAGTAGATTTGGGCAGG - Intergenic
1009189494 6:60612555-60612577 ATAGGGATTAAAGTTTGGGAAGG - Intergenic
1009650998 6:66478469-66478491 ATAGAGAAGCAGGACTGGGAAGG - Intergenic
1012277983 6:97296766-97296788 ATAGAAAAGCAGGTTTAGGCTGG + Intergenic
1014104117 6:117543846-117543868 ATAAGGAAACAGGCTTGGGGAGG - Intronic
1014297067 6:119631688-119631710 CCAGGGAATCAGGGTTGGGAGGG + Intergenic
1016363867 6:143295068-143295090 AAGGGGATGCAGGTTTGGGGTGG - Intronic
1016818339 6:148324375-148324397 ATGTGGGAGCAGGTTTGAGAGGG - Intronic
1017007962 6:150041457-150041479 ATAGGGAAGGAGGGGTGGGCAGG + Intergenic
1017508171 6:155087968-155087990 ATAGGATATCAGGATTGGGATGG - Intronic
1017777519 6:157691633-157691655 GTAGGGTGGCAGGTATGGGACGG - Intergenic
1018136116 6:160779834-160779856 ATAGGGAAGCGGGGTGGGGGGGG - Intergenic
1018351644 6:162965912-162965934 ATTGTGCAGAAGGTTTGGGATGG + Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1021363996 7:19753376-19753398 AAATGAAGGCAGGTTTGGGAAGG - Intronic
1022532530 7:31075979-31076001 ACAGGCAATCAGGTTTGGGCAGG + Intronic
1023475778 7:40576327-40576349 CAAGGGAAGCAGGTTTTGAAGGG + Intronic
1023784503 7:43692813-43692835 ATAGGGAAAGGGGTTTGGGAGGG - Intronic
1024371865 7:48594764-48594786 ATAATGAAGGAGGTTCGGGAAGG + Exonic
1024738023 7:52326910-52326932 ATAGAGACGCAGGTTTTGAAAGG + Intergenic
1024959919 7:54963264-54963286 ATTGGGCAGCAGTTTTGGCAGGG + Intergenic
1029074226 7:97923635-97923657 CTAGGAAGGCAGGTTTGGGCTGG - Intergenic
1029526472 7:101097645-101097667 ATTAGGAAGGAGGTTTGGGAGGG + Intergenic
1029968092 7:104761558-104761580 TGATGGAAGAAGGTTTGGGAAGG + Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031183971 7:118452494-118452516 AAAGGGAAACATGTTTAGGAGGG + Intergenic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1031918310 7:127583388-127583410 AAAGGGTCACAGGTTTGGGATGG + Intronic
1032817430 7:135491101-135491123 ATGAGAGAGCAGGTTTGGGAGGG + Intronic
1032873385 7:136010847-136010869 CTTTGGAAGCAGGTTTGGGAAGG + Intergenic
1033173970 7:139108664-139108686 AGCGGTAGGCAGGTTTGGGAAGG - Intronic
1034913522 7:155017827-155017849 CTGGGGAAACACGTTTGGGAAGG + Intergenic
1035188031 7:157140956-157140978 AGAGGGAAGCTGGGTAGGGAAGG + Intronic
1036257329 8:7216414-7216436 CTAGGAAGGCAGGTTTGGGCTGG - Intergenic
1036309376 8:7675010-7675032 CTAGGAAGGCAGGTTTGGGCTGG - Intergenic
1036360163 8:8071109-8071131 CTAGGAAGGCAGGTTTGGGCTGG + Intergenic
1036829245 8:12009538-12009560 CTAGGAAGGCAGGTTTGGGCTGG - Intergenic
1036890804 8:12595860-12595882 CTAGGAAGGCAGGTTTGGGCTGG - Intergenic
1037109636 8:15150485-15150507 AGGGGGAATTAGGTTTGGGAGGG - Intronic
1037583700 8:20261971-20261993 TTAGGGGAGGAGGTGTGGGACGG - Intronic
1037879811 8:22567001-22567023 GAAGGGAAGGAGGCTTGGGAAGG + Intronic
1039931019 8:41989157-41989179 ATACACAATCAGGTTTGGGAAGG + Intronic
1040801768 8:51350184-51350206 ATAGGGTCTCTGGTTTGGGACGG + Intronic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1042852790 8:73233561-73233583 ATTGGGAAGCAGGAATGGGAAGG - Intergenic
1043438220 8:80254495-80254517 ATAGGGAATCAGGGTAGGGTGGG - Intergenic
1043509039 8:80931735-80931757 ATAGGGAAGGAAGATTGGGAAGG - Intergenic
1044149198 8:88752562-88752584 ATAGGGTTGCCAGTTTGGGATGG - Intergenic
1044527551 8:93268661-93268683 AAAGAAAAGCATGTTTGGGAGGG + Intergenic
1045402778 8:101835325-101835347 GGAGGGAAGCGGGGTTGGGAGGG - Intronic
1045922145 8:107544259-107544281 AAAGGGAAGCAAGGATGGGAGGG + Intergenic
1046745286 8:117869187-117869209 ATATGGAGGCAGGCTTGGGCAGG - Intronic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1047344139 8:124010747-124010769 ATTGGGAAGCTGGTGGGGGAAGG + Intronic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048509580 8:135050096-135050118 ATAGCCATGCAGATTTGGGAGGG - Intergenic
1051027522 9:12630935-12630957 ATAGGTAGGCAGGGATGGGAAGG - Intergenic
1052025679 9:23571005-23571027 ATGGGTAGGCAGGTTTGTGAGGG - Intergenic
1054812691 9:69447329-69447351 AGAGGGAAGCTGGTTAGGGATGG - Intronic
1054822609 9:69538536-69538558 ATAGGAAAGGAAGTTGGGGATGG - Intronic
1055539007 9:77281119-77281141 AGAGGGTAGCAGGGATGGGAGGG + Intronic
1059485081 9:114620586-114620608 ATATGGAACAAGGTGTGGGAGGG + Intronic
1060106175 9:120874935-120874957 ATAGGGAAACAGGTGTGGCAAGG + Intronic
1060450539 9:123734535-123734557 ATAAGGCACCAAGTTTGGGATGG + Intronic
1061401939 9:130373295-130373317 AGAGGGAAGAGTGTTTGGGATGG - Intronic
1062575654 9:137206035-137206057 TTAGGGAAGGAGGTTTGGGAAGG + Intronic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1186186686 X:7027190-7027212 ATAGGGGAGCAGGGCTGCGATGG - Intergenic
1186755709 X:12669333-12669355 ATATGGGAGCTCGTTTGGGAAGG - Intronic
1187571485 X:20508247-20508269 ATGGGGAAGTAAGATTGGGAAGG - Intergenic
1187704148 X:21993053-21993075 ATTGGGCAGCAGGTTGGGGTGGG - Intronic
1189013401 X:37070645-37070667 AAGGGGAAGAAAGTTTGGGAAGG - Intergenic
1189850662 X:45173331-45173353 ATAGAGGAGCAGGCTTGGGTAGG + Intronic
1190085309 X:47390325-47390347 AAAGGGAAGCTGATTTGTGAAGG + Intronic
1190441193 X:50475960-50475982 GTAGGTAAGCAGGAGTGGGATGG + Intergenic
1190451390 X:50584777-50584799 AGAGGGAATCAGGTTCGGGAGGG + Intergenic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1197178887 X:123512968-123512990 AAAAGGAAGCAGGATTGGGCAGG - Intergenic
1198045835 X:132901713-132901735 CCAGGGAAGCAGATTTGAGATGG + Intronic
1199460518 X:148078701-148078723 AAAAACAAGCAGGTTTGGGAAGG + Intergenic
1199617767 X:149671459-149671481 ATAGGGTAGAAGTCTTGGGAGGG + Intergenic
1199624875 X:149731790-149731812 ATAGGGTAGAAGTCTTGGGAGGG - Intergenic
1201296449 Y:12467219-12467241 AGAGAGAAGCAGGGTTGGGGTGG - Intergenic
1201562154 Y:15329024-15329046 ATAGGGGAGCAGGCCTGCGATGG - Intergenic