ID: 1141049210

View in Genome Browser
Species Human (GRCh38)
Location 16:80745440-80745462
Sequence ACAGCTAGTAAGTGTCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 15, 3: 48, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141049210 Original CRISPR ACAGCTAGTAAGTGTCAGGC TGG (reversed) Intronic
901940320 1:12656842-12656864 AAAGCTACTCAGTGTAAGGCTGG + Intronic
902145421 1:14394873-14394895 CCAGCTAGTGAGTGACAGACAGG + Intergenic
903212689 1:21827684-21827706 CCAGCCAGTAAGTGTGGGGCAGG + Intronic
903306131 1:22414588-22414610 CCAGCTAGTTAGCGACAGGCTGG - Intergenic
903677198 1:25071860-25071882 TCAGCTAGTTAGTGGCAGGGCGG + Intergenic
903807272 1:26014326-26014348 ACAGCCAGTGAGTAACAGGCTGG - Intergenic
904110977 1:28125819-28125841 ATAGTTAGTAAGTGGCAGGGTGG - Intergenic
904196651 1:28790676-28790698 ACAACTAGTAAGTGCAAGACTGG - Intergenic
904344480 1:29859134-29859156 ACATCTAGTAAGTGGCAGAGTGG + Intergenic
904812322 1:33171440-33171462 ACAGCTAGTAAGAGGCAGAGGGG + Intronic
904962874 1:34348564-34348586 ACAGCCAGTAACTTTGAGGCAGG - Intergenic
905231583 1:36517773-36517795 ACAGCCAGTAAGTGGCAGAGTGG + Intergenic
906274334 1:44505149-44505171 ACAGCTTCTAAGTGGCAGTCAGG + Intronic
907389176 1:54145512-54145534 AGAGACAGGAAGTGTCAGGCAGG + Intronic
907463298 1:54618797-54618819 ACAGCTGGAAAGTGTTAGGGTGG - Intronic
907723214 1:56993493-56993515 ACAGCTAGTATGTGCCAGGCAGG - Intergenic
908483473 1:64567127-64567149 ACCTCTAGTAAGTGGTAGGCAGG + Intronic
908648916 1:66310791-66310813 AGATCTAGTAAGTGTCAGCCAGG - Intronic
908824061 1:68116491-68116513 ACAGCTAGGAAGTAACAGCCTGG - Intronic
911231002 1:95361709-95361731 ACAGCTACTAAGTGACTAGCAGG - Intergenic
911328038 1:96492382-96492404 ACAGCTAGTACGTGGCAGAGGGG + Intergenic
911657433 1:100461100-100461122 ACAGCTAGTACCTTTAAGGCTGG + Intronic
912334501 1:108849720-108849742 CCAGCAAGTAAGTGTCAGAGTGG - Intronic
915708517 1:157870865-157870887 ACAGCTAGTAAGTGACAGAGTGG + Intronic
916474397 1:165154858-165154880 ACAGCTCCTCAGTTTCAGGCAGG + Intergenic
917380442 1:174400443-174400465 TCATCTAGAATGTGTCAGGCAGG - Intronic
917926337 1:179792053-179792075 ACATCTAGTAAGTGGCAGTCAGG - Intronic
919978250 1:202626797-202626819 AGAGCTGCTAAGTGTCAGGTTGG - Intronic
920112481 1:203597112-203597134 ACAGCTGGGAAGTGACAGACAGG - Intergenic
920371143 1:205480157-205480179 ACAGCTAGAAAGTAACAGGTAGG + Intergenic
921861270 1:220044843-220044865 ACAACTAGTAAGTGGCAGCCAGG + Intronic
921976054 1:221204607-221204629 CCAGCCAGTAAGTGACAGTCTGG - Intergenic
1063005822 10:1969865-1969887 ACAGCTAGGAAATCTCATGCAGG - Intergenic
1063213841 10:3906165-3906187 ACAGCTAGTTAGTGACACGAGGG + Intergenic
1063336089 10:5215861-5215883 ACAGTTTGGAAGTGTCAGGAGGG - Intronic
1063380409 10:5581987-5582009 ACAGGTAGCAAGTGGCAGCCAGG + Intergenic
1063500156 10:6546106-6546128 ACAGCTAGTAAGTGGGATGGTGG + Intronic
1063738803 10:8794542-8794564 ACATCTAGTAAGTGGGAGGAAGG - Intergenic
1064253696 10:13726599-13726621 TGAGCTCGTAAGTCTCAGGCGGG + Intronic
1067709050 10:48634255-48634277 ACAGCTAGTTAGTGGCAGACAGG - Intronic
1068918946 10:62463190-62463212 ACAGCTAGAAACTGTGGGGCAGG + Intronic
1069242863 10:66163752-66163774 GCAGCTAGTGATTGTCAGTCTGG - Intronic
1069884712 10:71616339-71616361 ACAGCAATTAAGGGCCAGGCTGG - Intronic
1069948078 10:72001033-72001055 ACAGCTGGGAGGTGGCAGGCAGG + Intronic
1070153506 10:73819516-73819538 TCAGCCAGTAAGTGTGAGGGAGG - Exonic
1070470037 10:76769517-76769539 ACAGGTAGTAAGTGGCTGGTTGG - Intergenic
1070654694 10:78263278-78263300 ACAGTTAGCAAATGGCAGGCTGG - Intergenic
1071165717 10:82804038-82804060 ACAGCTACTAAGTGACTGGTGGG - Intronic
1071319127 10:84435213-84435235 ACAGCTAGTTACTGTCAGATAGG + Intronic
1071355368 10:84788450-84788472 ACAGCTAGTAAGTGGAAGAATGG - Intergenic
1071553678 10:86586215-86586237 ACAGTGAGAAAGTGTCAGGCAGG - Intergenic
1071747341 10:88437095-88437117 ATAGCTAGTATTTTTCAGGCAGG - Intronic
1072195889 10:93116910-93116932 ACAGCAAGTGAGTGTCAGGGTGG + Intergenic
1072250401 10:93577803-93577825 ACAGCTTGTAAGTGGCAATCAGG + Intronic
1072363295 10:94682298-94682320 ACAGCTCATAAATGGCAGGCTGG - Intergenic
1072383925 10:94904340-94904362 ACAGCTCATAAATGGCAGGCTGG - Intergenic
1073564286 10:104521975-104521997 ACAGCTAGTGAGGAGCAGGCTGG + Intergenic
1073693886 10:105843859-105843881 ACAGCTAATATTTTTCAGGCTGG + Intergenic
1073749465 10:106507722-106507744 ACAGCTAGTAAATGACAGACTGG + Intergenic
1074394080 10:113082891-113082913 ACAGCTAGTCAGTGGGAGGGTGG + Intronic
1075297999 10:121294835-121294857 TCAGCTGGTAAGTGTCAGAGAGG - Intergenic
1075359602 10:121818686-121818708 ACTGCTAGTAAATGTGAGGCAGG + Intronic
1075973397 10:126673802-126673824 ACAGCTGGTGTCTGTCAGGCAGG - Intergenic
1076198254 10:128536381-128536403 ACAGCTACTAAGTGACAAGTGGG + Intergenic
1077461956 11:2715222-2715244 ACAGCTAGAAAGTGGCCAGCTGG + Intronic
1078717041 11:13850198-13850220 ACAGCTAGTAAGTATGAGCTGGG + Intergenic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1080421435 11:32114509-32114531 ACACCTGGTATGTGTCAGGACGG + Intergenic
1080891459 11:36412130-36412152 ACAGCTACTAAGTGGCTGCCAGG + Intronic
1081049993 11:38326967-38326989 ACAACTAGTAAGTCGAAGGCCGG - Intergenic
1081320228 11:41683158-41683180 ACAGCTAGTAACTGGCAGAGGGG - Intergenic
1081460313 11:43266801-43266823 ACAGGTAGAAAGTGGCAGACTGG - Intergenic
1083007975 11:59366887-59366909 ACAGCTAGTAAGTGAAGGGGTGG + Intergenic
1083334053 11:61912635-61912657 ACAGCAAGGAAGTGGCAGGATGG + Intronic
1083795927 11:65016682-65016704 ACAGCCCAGAAGTGTCAGGCAGG + Intronic
1083869880 11:65480240-65480262 ACAGCTAGTAAAAATAAGGCAGG - Intergenic
1083980084 11:66160238-66160260 GCAGCTAGTAGGTGTCAGCCAGG - Intronic
1084543066 11:69799235-69799257 ACAGCCACTCAGTGTCATGCTGG + Intergenic
1085363361 11:75913674-75913696 ACAGCAAGTAAGAGCCAGACTGG + Intronic
1086047130 11:82546462-82546484 ACAGCTACTTAGTGGCAGGAAGG - Intergenic
1087902030 11:103651661-103651683 ACAGCTAGAAAGTTGAAGGCTGG - Intergenic
1089299615 11:117490702-117490724 ACAGCTGGTGAGTGGCAGGAAGG + Intronic
1089376129 11:117996110-117996132 ACAGCCAGGAAGAGTCAGGGAGG + Intronic
1090272417 11:125397536-125397558 ACAGATAGTAAATGACAGGCCGG + Intronic
1090944063 11:131413989-131414011 ATAGCTAGTTAGGGTCAAGCTGG - Intronic
1091173714 11:133541462-133541484 CCCACAAGTAAGTGTCAGGCAGG + Intergenic
1091815331 12:3433536-3433558 ACAGCTGGTAAGTGGCAGAGTGG + Intronic
1092489343 12:8930904-8930926 TGAGCTAATAAGTGTCTGGCTGG - Exonic
1092970976 12:13694548-13694570 ACAGCTAGTAAGTGACAGACTGG + Intronic
1093446381 12:19264258-19264280 ACAGCTAGTTAGTGTTAGGCAGG + Intronic
1094478970 12:30865052-30865074 ACAGCTAGTAAGAGACAGAGTGG - Intergenic
1095951891 12:47786102-47786124 ACAGCTAGTAAGTGGCAGCAAGG + Intronic
1096614769 12:52825791-52825813 ACAGCCAGTGCGTGTTAGGCTGG - Intronic
1096946449 12:55413633-55413655 TGAGCTAATAAGTGTCTGGCTGG + Intergenic
1097589301 12:61554140-61554162 ACAGCTAGTTAGTGGCAGAATGG - Intergenic
1098378671 12:69844632-69844654 ACAGCTTGTAAGTGACACACAGG - Intronic
1100891519 12:99131461-99131483 ACAAATAGTAAGTGTCTGGGAGG + Intronic
1101259561 12:103014342-103014364 ACAGCTAGAAAGAATCAGACAGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102560006 12:113755126-113755148 ACAGCTAGTGAGTGGCAGAGTGG - Intergenic
1103125737 12:118420876-118420898 ACAGCCAGTAAATGGCAAGCCGG + Intergenic
1105429922 13:20327015-20327037 GCAGCTAGAAAGTGTCAGAGTGG - Intergenic
1106085898 13:26541339-26541361 ACAGCTATTAAGTGGCAGGCTGG - Intergenic
1107005702 13:35608556-35608578 ACAACTAGTATGTGCCAAGCAGG - Intronic
1107061817 13:36167369-36167391 ACAGCTTGTAAGTTTCACGGTGG - Intergenic
1107267334 13:38571902-38571924 AAAGCTAGTAAATGTCATTCTGG + Intergenic
1109199963 13:59419408-59419430 ACAGCAAGTTAGTGGGAGGCTGG + Intergenic
1110495328 13:76161459-76161481 ACAACTAGTAAATGGCAGGGTGG - Intergenic
1110825489 13:79966954-79966976 GCAGCTAGTAAATGACAGCCAGG - Intergenic
1111592228 13:90364273-90364295 ACAGCTACTTAGTGGCAGGTTGG + Intergenic
1114056799 14:18976625-18976647 ACAGCAATTAATTGTCATGCAGG - Intronic
1114105751 14:19425118-19425140 ACAGCAATTAATTGTCATGCAGG + Intronic
1117226317 14:53663952-53663974 ACAGCTTGCAATTGTCAGTCTGG + Intergenic
1119167340 14:72505687-72505709 ACAGCTGGTAGGTGGCAGCCAGG - Intronic
1119466767 14:74864446-74864468 GCAGCTCGTAAGTGACAGACTGG + Intronic
1119656769 14:76422777-76422799 ACAGCGAGTCAGTGACAGGCCGG + Intronic
1119666750 14:76490586-76490608 ACAGCTAGTAAGCGGGAGTCAGG + Intronic
1120904629 14:89609662-89609684 ACAGCTGTTAAGTGGCAGGGAGG + Intronic
1121719047 14:96096607-96096629 ACAGAAAGTAAGTGTGGGGCTGG + Intergenic
1122748702 14:103917183-103917205 TTAGCTAGTAAGTGACAGCCAGG - Intronic
1124493875 15:30174731-30174753 AGAGCTGCTAAGTGTCAGGTTGG - Intergenic
1124749693 15:32363915-32363937 AGAGCTGCTAAGTGTCAGGTTGG + Intergenic
1125067313 15:35503861-35503883 AAAGCTAGTAAGTGGCAGCTGGG + Intronic
1125253370 15:37732510-37732532 ACAGCTACTAAGTGACAAACAGG + Intergenic
1127094190 15:55496441-55496463 ACAGCTAGTGACTGGCAGCCTGG - Intronic
1127310850 15:57751000-57751022 ACAGCTAGAAAGTGTCAGGACGG - Intronic
1127385095 15:58460634-58460656 TCAGCCAGTAAGGGCCAGGCTGG + Intronic
1127427963 15:58874571-58874593 ACATCTAGTAAATGGCAGACTGG + Intronic
1128074371 15:64817022-64817044 ACAGTTAGTGAGTGGCAGCCTGG - Intronic
1128137908 15:65277618-65277640 ACAGCTATTCAGTGGCAGGGTGG + Intronic
1128495036 15:68192961-68192983 ACAGCTAGAAGGTGCCAGGTTGG - Exonic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1132315673 15:100888675-100888697 ACAGCTAGTAAGTGGCAGAGTGG - Intronic
1133390337 16:5405101-5405123 ACAGCTATTAAGTGTCAGAATGG + Intergenic
1134667277 16:16028008-16028030 ACAGCTAGGAAATGGCAAGCTGG + Intronic
1134685040 16:16152697-16152719 ACAGCTAGTAAGTGGCAGGGCGG + Intronic
1134884745 16:17780613-17780635 ACAGCTAGTAAATGGCAAGGTGG + Intergenic
1135027261 16:19008019-19008041 ACAGCTAATAAGTGACAGAGTGG + Intronic
1135342858 16:21664021-21664043 ACAGATAGGAAGTCCCAGGCGGG + Intergenic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1135792890 16:25414148-25414170 ACAGCTAGTAAATGACAGCCAGG - Intergenic
1138761604 16:59550514-59550536 ACAGAGAGTAACTGTCAGGCAGG + Intergenic
1139363700 16:66419598-66419620 ACAGCAAGTAAGTGGCAGAAGGG + Intergenic
1140232411 16:73128467-73128489 ACAGCTTATAAATGACAGGCAGG + Intronic
1140560293 16:75972382-75972404 TCAGCCAGCAACTGTCAGGCAGG + Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1141760313 16:86024865-86024887 ACAGCCAGTAAGTGGCAGAGTGG + Intergenic
1141843498 16:86590698-86590720 GTAGCTAGTAAGTGGCAGGCTGG + Intergenic
1142026839 16:87818954-87818976 CCAGGAAGTAACTGTCAGGCTGG - Intergenic
1142554305 17:762761-762783 ACACTGAGTAAGTGGCAGGCAGG - Intronic
1144590582 17:16520510-16520532 ATAGCTAGTAAGTGTCCGAGAGG + Intergenic
1144664918 17:17095842-17095864 ACAGCTAGGAGGAGGCAGGCTGG - Intronic
1145853862 17:28133322-28133344 AGAGCTAGTAAGTGTGGGGATGG + Intronic
1146176893 17:30670880-30670902 ACAGCTAATAACTGTGAAGCCGG - Intergenic
1146350356 17:32086980-32087002 ACAGCTAATAACTGTGAAGCTGG - Intergenic
1147357256 17:39907789-39907811 AGAGCTAGTGAGTGGCAGGGTGG + Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1147600249 17:41740739-41740761 ACAGCCAGGAAGTATCAGGGAGG + Intergenic
1147696487 17:42358704-42358726 ATAGCTAATAAATGTCAGGCAGG - Intronic
1147764166 17:42822425-42822447 TCAGCTAGTAAATGACAGCCAGG + Intronic
1148601357 17:48896591-48896613 AGAGCTAGTAAGTGGCAGATTGG + Intergenic
1149006384 17:51810554-51810576 GGAGCTGGGAAGTGTCAGGCAGG + Intronic
1149646798 17:58246968-58246990 ACAACTAGAAAGTGGCAGTCAGG + Intronic
1149775943 17:59357250-59357272 AAAACTAGTTGGTGTCAGGCAGG - Intronic
1150125137 17:62630378-62630400 ACCCCTAGTAAGTGAAAGGCTGG + Intronic
1152922001 17:83070387-83070409 ACACCTAGAAAGGGTCAGGAGGG + Intergenic
1153641214 18:7158681-7158703 ACTGATAGTAAGTGGCAGGGTGG - Intergenic
1153927994 18:9851546-9851568 ACAGCTAATAAGTGAGAGACAGG + Intronic
1153995849 18:10440828-10440850 AAAGCTAGTAAGTGATAGCCCGG + Intergenic
1155985603 18:32227511-32227533 ACAACTAGTTAGTGTGTGGCTGG - Intronic
1156783849 18:40884642-40884664 ACAGCTAGTAAGGGGCAGAGTGG - Intergenic
1156871411 18:41950049-41950071 ACAGAAAGTAATTGTCAGGTGGG - Intergenic
1157148335 18:45189116-45189138 AAAGCTAGTAAGTGGCAAACTGG + Intergenic
1157282942 18:46358163-46358185 ACAGCTAGGATGAGTCATGCAGG + Intronic
1157402072 18:47396898-47396920 ACAGAAAGTCAGTGGCAGGCTGG + Intergenic
1157887352 18:51381805-51381827 TTAGCTAGTAAGTGACAGTCTGG + Intergenic
1159853894 18:73560776-73560798 ACTGCTGGTATATGTCAGGCAGG + Intergenic
1162087422 19:8257090-8257112 GCAGCTGGGAAGGGTCAGGCAGG - Intronic
1162981925 19:14246030-14246052 ACAGCTAATAACTGTGAAGCCGG + Intergenic
1163725384 19:18920482-18920504 ACTGCCAGTGAGTGGCAGGCTGG - Intronic
1163774716 19:19211488-19211510 ACAGCTGGTAAGAGGCACGCAGG - Intergenic
1164115321 19:22214149-22214171 ACTGCAAGTCAGAGTCAGGCTGG + Intergenic
1164527424 19:29022383-29022405 ACAGCTGGTAAGGGTGGGGCTGG + Intergenic
1165083173 19:33322927-33322949 ACGGCTAGTAAGTGTTAGCGTGG + Intergenic
1166824489 19:45600649-45600671 ACAGTGAGTCAGTGCCAGGCTGG - Intronic
1167660336 19:50792389-50792411 ACAGCTAGTGAGTAGCAAGCTGG - Intronic
1167755898 19:51413563-51413585 ATAGCTAGTAAGTGCCAGGCAGG + Intronic
925981322 2:9179837-9179859 ACAGCTAGCAAGTGCCTAGCTGG + Intergenic
926114410 2:10203318-10203340 ACAGCTAGTGGGTGGCAGTCGGG - Intronic
926951434 2:18247842-18247864 CCAGCAAGAAAGTGGCAGGCTGG - Intronic
928612872 2:33007921-33007943 ACAGCTAGTCAGTGTTGAGCTGG + Intronic
929316241 2:40482624-40482646 ACAGCTGGTAAGTGGCAGAGTGG + Intronic
929531988 2:42758515-42758537 CCAGCTAGTAAGTGGCAGTCTGG - Intergenic
930204394 2:48573508-48573530 ACAGCTAGTGAGTGACAGAGTGG + Intronic
930445128 2:51461093-51461115 ACAGCTAGTAAGCAGCAGGTGGG + Intergenic
930736174 2:54781211-54781233 ACAGCTAGTGAGTGGCAGGCTGG + Intronic
932137066 2:69240749-69240771 ACAGCCAGTAAGTGGCAGAGTGG - Intronic
932431054 2:71673703-71673725 ATAGCTAGGAAGTGGCAAGCTGG - Intronic
932608238 2:73178215-73178237 GCAGCTAGTAAGTGGCAGAAGGG - Intergenic
932867070 2:75354948-75354970 ATAGTTAGTAAGTGTGGGGCAGG - Intergenic
932867549 2:75361462-75361484 TCAGCTCGTTAGTGTCAGGTGGG - Intergenic
933970365 2:87465061-87465083 ACAGCTAGCAAGAGGAAGGCAGG - Intergenic
935341305 2:102062018-102062040 ACAGCTAGTAAATGGCAGAGCGG + Intergenic
936323418 2:111485435-111485457 ACAGCTAGCAAGAGGAAGGCAGG + Intergenic
936620157 2:114087667-114087689 ACAGCTTTTGAGTATCAGGCTGG - Intergenic
937433316 2:121859351-121859373 ACAGCTAGTAAGTGTTGGGTTGG - Intergenic
937840088 2:126516022-126516044 ACAGCAAGTAAGAGGCAGGAAGG - Intergenic
937854061 2:126660128-126660150 ACAGCTTGTATGTGCCAGGCAGG + Intronic
937867417 2:126763394-126763416 ACAGCTAATATGTGGCAGTCTGG + Intergenic
937900066 2:127012999-127013021 ACAGCTAGTAAGTGCTAGACTGG + Intergenic
939154776 2:138511865-138511887 ACAGCTATTAAATGGCAGGGTGG - Intronic
940470822 2:154097977-154097999 ACAGCTAGTCAGTGGCAGACTGG + Intronic
942518273 2:176775983-176776005 ATAGCTAGTAGGTGGCAAGCAGG + Intergenic
942745067 2:179222274-179222296 ATAGCTAGTAAGTGGCTGGCCGG - Intronic
943515588 2:188881951-188881973 ACAGCTAGCAAGCGACAGTCAGG - Intergenic
944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG + Intergenic
944879289 2:203994927-203994949 ACAGCTAGGAAGTGGCAGAGTGG + Intergenic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
946109971 2:217406309-217406331 ACAGCCAGTAAGTGTAAGCTGGG - Intronic
946735851 2:222753865-222753887 AGAGCTAGTAAGTGTCTGAGCGG + Intergenic
947609105 2:231511824-231511846 AGAACTAGTAAGTGACAGCCAGG - Intergenic
1168917983 20:1506925-1506947 ACAGCTCCTAAGTGCCTGGCTGG - Intergenic
1169318563 20:4612487-4612509 ACAGCTAGTTAGTGACAGAGCGG - Intergenic
1169498885 20:6140430-6140452 ATAGCTAAGAAGTGTCAGGCTGG + Intergenic
1170651391 20:18245656-18245678 CCAGCTAGTAAGTGGCAGAGTGG - Intergenic
1170974713 20:21151162-21151184 ACAGCTAGTAAGTGGCATACTGG + Intronic
1171171265 20:23017467-23017489 ACAGCTGGCAAATGTCAGCCAGG + Intergenic
1172408512 20:34705968-34705990 ACAGCAAGTCAGTGACAGCCAGG - Intronic
1172693114 20:36804037-36804059 CCGGCTAATAAGTGTCAGACTGG - Intronic
1174362286 20:50036534-50036556 ACAGCTAGCAAGTGACAACCAGG + Intergenic
1175497199 20:59423321-59423343 CGAGCTAGCAAGTGGCAGGCAGG - Intergenic
1176921440 21:14692185-14692207 TCAGCTAGTAAGTACCAGGGTGG + Intergenic
1176938437 21:14894611-14894633 ACAGATAGTAAGTGGCAGACTGG - Intergenic
1177171416 21:17660060-17660082 ACAGCTAGAAAGCATCAGTCAGG + Intergenic
1180475284 22:15699238-15699260 ACAGCAATTAATTGTCATGCAGG - Intronic
1180976526 22:19851751-19851773 AGAGCTCGTAATCGTCAGGCAGG + Exonic
1182136399 22:27907788-27907810 ACAGCTAATAAGTGACAGAATGG - Intronic
1182991280 22:34770323-34770345 ACAGCTTGTAAGAGTCACACAGG + Intergenic
1183198417 22:36369131-36369153 ACAGCTAGTCAATGGCAGGAGGG + Intronic
1183993113 22:41612109-41612131 CCACCTAGTAAGTGTCATGAAGG - Intronic
1184900734 22:47444967-47444989 ACAGCAGGAAAGTGTCAGGTGGG + Intergenic
1184978381 22:48079229-48079251 ACAGCGAGTAACTGGCAGGCAGG + Intergenic
950381726 3:12621223-12621245 ACAGCTTGTAAGTGGCAAACTGG + Intronic
950401177 3:12769927-12769949 ACAGCTGGTAAGTCACAGTCAGG - Intergenic
952072935 3:29661016-29661038 ATAGCTAGTAAGAGTCAGAGTGG - Intronic
953235672 3:41104030-41104052 ACTGGTAGTATGTGTCAGTCAGG + Intergenic
953722176 3:45366021-45366043 ACAGCTAGCAAGTGCTAGACTGG - Intergenic
956008579 3:64806345-64806367 ACAGCTAGTATATGTCAGTGGGG - Intergenic
956248858 3:67214679-67214701 ACAGCTAGTAAGTTGCAGAAAGG + Intergenic
956875632 3:73459876-73459898 CCAGCTAATACGTGGCAGGCAGG + Intronic
957388448 3:79529612-79529634 ACAGCTAATAAGTGACAAACAGG + Intronic
960697499 3:120410371-120410393 ACAGCTAGTAATTGGCAGACTGG - Intronic
961808276 3:129504824-129504846 ATAGCTAGGAAGTGGCAGGGAGG + Intronic
962340284 3:134576568-134576590 ACAGCTGCTAAGTGGCAAGCTGG - Intergenic
963540361 3:146579976-146579998 AAAGCTAGGAAGTGTTTGGCTGG - Intronic
964711011 3:159671626-159671648 ACTGCCAGTAAATGACAGGCTGG - Intronic
967345806 3:188454172-188454194 GCAGCTAGCAGGTGACAGGCAGG + Intronic
967448304 3:189594082-189594104 ATAGATAATAAGTGTCAGGGAGG + Intergenic
967711829 3:192717253-192717275 ACAGCTAGTAAGTTGCAGACTGG - Intronic
968755299 4:2412713-2412735 AGAGCTGGTAAGTGACAGCCAGG - Intronic
969158657 4:5235900-5235922 AGAGCTAGTAAGTGATGGGCAGG - Intronic
969245696 4:5931308-5931330 ACACCTAGTAAGTATCAGTTAGG + Intronic
969341643 4:6545702-6545724 CCAGCTAACAAGAGTCAGGCAGG - Intronic
969347356 4:6577614-6577636 ACAGCTTGTAAGCGGCAGGTGGG + Intronic
969429234 4:7144676-7144698 ACAGCTAGTAAGTGGCAGAGTGG + Intergenic
970207984 4:13675296-13675318 ACAGTTAGTAAGTGGCAGATTGG + Intergenic
973974061 4:56244539-56244561 TCAGCTAGTATATGTCAGGGTGG + Intronic
974382961 4:61165532-61165554 CCAGCCAGTAATTGTGAGGCTGG - Intergenic
975387568 4:73775109-73775131 AAACCTAGAAAGTGTCAGTCTGG + Intergenic
975433389 4:74321466-74321488 ACAGCTAGTAGGAGTGAAGCTGG - Intergenic
975777412 4:77802793-77802815 ACAGCTAGTAAGTGGCTAGACGG + Intronic
975844128 4:78507144-78507166 ACTGCCAGCCAGTGTCAGGCAGG + Intronic
976113098 4:81698209-81698231 ACAGCTAGCAAGTGGCAAGCAGG + Intronic
977794091 4:101141662-101141684 AGAGATAGAAAGTGTCAGGTAGG - Intronic
979297494 4:119050434-119050456 AAAGCTAGTAAGTGTTGGGGTGG - Intronic
979837954 4:125397318-125397340 CTAGCTAATAAGTGTCAGACAGG + Intronic
980180584 4:129395490-129395512 ACAGATATGAAGTCTCAGGCAGG - Intergenic
980417929 4:132517642-132517664 AAAGCTAGTAAGTTGCAGCCTGG - Intergenic
980963882 4:139502072-139502094 ACAGCTAGAAATTGCAAGGCTGG + Intronic
982629957 4:157819586-157819608 ACTGCTAGTACGTGTCTGCCAGG + Intergenic
985654207 5:1121616-1121638 ACAGCCAGTGAGTGGCAGGCAGG + Intergenic
986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG + Intronic
987329520 5:16843493-16843515 ACAGTTAGTAAGCAGCAGGCAGG + Intronic
988807714 5:34755918-34755940 ACAACATGTAAGTGTCAGTCTGG + Intronic
988908417 5:35814281-35814303 ACAAGTAGTAAGTCTCAGGGTGG + Intronic
990476137 5:56163300-56163322 ACAGCAAGGAAGTCCCAGGCTGG - Intronic
992017768 5:72593465-72593487 ACAGCTAGTAATGTTGAGGCAGG + Intergenic
992095073 5:73355471-73355493 ACAGCCAGTATGTGACAGGAAGG - Intergenic
992499118 5:77324319-77324341 ACATCTAGGAAGTGCCAGCCTGG + Intronic
996452332 5:123639709-123639731 ACAGCTAGTTAGTGGCATGAGGG - Intergenic
997002314 5:129776251-129776273 ATAGCCAGTCAGTGTCAGGAGGG - Intergenic
997262117 5:132473442-132473464 ATAGCTAGTAAGTGGCAGAGTGG + Intronic
998390069 5:141781640-141781662 CCAGCAAGTGAGTGGCAGGCAGG + Intergenic
998478778 5:142443942-142443964 ACAGCTAGCAAGTGACAGACTGG - Intergenic
998859898 5:146432325-146432347 ACAGCTAGTAAGAGGCAGATCGG + Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
999483423 5:151969972-151969994 ACACCTACTCTGTGTCAGGCAGG + Intergenic
999511907 5:152261029-152261051 ACAGCTAGTACGCGTCAAGATGG + Intergenic
999683076 5:154077776-154077798 TCAGCTAGTAAGAAACAGGCTGG - Intronic
999716959 5:154368976-154368998 ACAGCTGGTAGGTGACAGCCAGG - Intronic
999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG + Intronic
1001926689 5:175642303-175642325 ACAGCCAGTAAGTGGCAGAGCGG + Intergenic
1002047461 5:176549964-176549986 AGTGCTAGGAAGTGTCAGGCAGG + Intronic
1002230955 5:177763746-177763768 ACAGCTATGAAGTGCTAGGCAGG + Intronic
1002264383 5:178020002-178020024 ACAGCTATGAAGTGCTAGGCAGG - Intronic
1003487246 6:6590293-6590315 ACAGCTACTAAGTGACGGACAGG + Intronic
1006374864 6:33666230-33666252 ACAGCTAGGAAGCGGCAGCCAGG + Intronic
1007408481 6:41648269-41648291 ATAGCTAGCAAGTGTCAGAGAGG - Intronic
1007448059 6:41921887-41921909 GCAGCTAAAAAGTGTCTGGCAGG + Intronic
1007932325 6:45703048-45703070 ACAACTACTATGTGCCAGGCAGG + Intergenic
1008166494 6:48145258-48145280 ACTGCTAGTCAGTCTGAGGCAGG + Intergenic
1010674529 6:78725964-78725986 ACAGCTAGTTAGTGGCAGATAGG - Intergenic
1011029319 6:82904464-82904486 TCAGCTAGTAAATGTCGGGGAGG - Intronic
1011207826 6:84919726-84919748 ACAGCTAGAAAGTGGCAGAATGG + Intergenic
1011226104 6:85108990-85109012 ACAGCTGGTTAGTGGCAGACTGG - Intergenic
1011497916 6:87954389-87954411 ACAGCTAGTCAGTGACAGCTGGG + Intergenic
1012255637 6:97028186-97028208 CCATCTAGTAAGTGTCGGGTAGG + Intronic
1012507306 6:99962202-99962224 ACAGCTACTAAGTGACTAGCAGG + Intronic
1014486888 6:122009991-122010013 ACAGCTATTAAGTGACTGGGCGG - Intergenic
1014634402 6:123826992-123827014 ACAGAAAATAAGTGTCAGCCAGG - Intronic
1014980822 6:127944585-127944607 TCAGCTAGTAGGTGGCAGACAGG + Intergenic
1015119182 6:129682688-129682710 ACATCTAGTTAATGCCAGGCAGG - Intronic
1017541717 6:155409363-155409385 ACAGCTAGTGAGTGGGAGTCAGG + Intronic
1018361906 6:163079020-163079042 ACAGCTAGTTAGTAGCAAGCTGG - Intronic
1019503055 7:1375081-1375103 AAAGAAAGAAAGTGTCAGGCTGG - Intergenic
1021845707 7:24760434-24760456 TCAGCTGGTAAGTGGTAGGCTGG - Intergenic
1022878384 7:34560390-34560412 ACAGCTAGTCAGAGTGGGGCAGG + Intergenic
1022915274 7:34943424-34943446 AGAGCTAGTAAGTGGCAGCCAGG + Intronic
1025742720 7:64212257-64212279 ACATCCAGTAAGTGGCAGTCTGG - Intronic
1026111303 7:67460816-67460838 ACAACTGGTCAGTTTCAGGCAGG - Intergenic
1026434069 7:70378601-70378623 ACAGCTAGTATGTGGCAGACAGG + Intronic
1027512605 7:79101810-79101832 ATAGCTATTAAGTGTTTGGCTGG - Intronic
1031697153 7:124872481-124872503 ACAGCTACTAAGTGACAAACAGG - Intronic
1034138144 7:148790748-148790770 ACAGCTGATGTGTGTCAGGCAGG - Intronic
1034613723 7:152396072-152396094 ACAGCTACTAAGTGTGAGGCTGG + Intronic
1035533547 8:374366-374388 ACAGCCAGTAAGTGTCTAGCAGG + Intergenic
1036436540 8:8739461-8739483 ACAGCATGTAAGTGTGAAGCTGG - Intergenic
1036754327 8:11462279-11462301 AGAACTAGTAAGTGGCAGGCTGG - Intronic
1037159790 8:15755164-15755186 ACAGCTAGTAACGAGCAGGCTGG - Intronic
1038792894 8:30684352-30684374 ACAGCTGGCAAGTTTCAAGCTGG + Intronic
1038923632 8:32113484-32113506 GCAGCTAGCACCTGTCAGGCTGG - Intronic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1044298711 8:90558190-90558212 ACAGCTAGTAAGTGGGAGGTTGG - Intergenic
1044900918 8:96943580-96943602 ACAGCAAGAAAGTAGCAGGCTGG + Intronic
1045979226 8:108164967-108164989 ATAGCTGGTAAGTGACATGCTGG + Intergenic
1047154791 8:122304612-122304634 AGAGCTAGTAAGTGCCAAGTTGG - Intergenic
1047286327 8:123490311-123490333 ACAGCTAGGAAGTGGTGGGCTGG + Intergenic
1047612310 8:126533114-126533136 ACAACTAGAAAGTGGCAGTCTGG - Intergenic
1048190547 8:132284426-132284448 ACAGCTAGGAAGTGCCAAGGTGG + Intronic
1048255124 8:132899931-132899953 ACAGCTGGTGAGTGAGAGGCAGG - Intronic
1050371369 9:4924672-4924694 ACAGCTGGTAACTGAGAGGCAGG + Intergenic
1050816874 9:9824956-9824978 ACAGCTAGTAAGTACCAGTGAGG - Intronic
1054936958 9:70698332-70698354 ACAGCTAGTAAGAGACAGGACGG - Intronic
1056985286 9:91358400-91358422 ATAGCTAGTAAGCGGCAGACTGG - Intronic
1057914543 9:99045702-99045724 ACAGCTTGTAAGTGGCAGAGTGG + Intronic
1058620511 9:106878138-106878160 AAAGCTAGGAAGTGGCAGGCAGG - Intronic
1058668199 9:107339417-107339439 ACAGCTACCAAGTGACAGCCAGG + Intergenic
1058824263 9:108760736-108760758 ACAGCCAGTAATTGGCAGGTAGG + Intergenic
1058923116 9:109637063-109637085 AAAGCTAGTAAATGTAAAGCTGG + Intergenic
1059247521 9:112861473-112861495 ACACCTGGTAAGTGGCAGGTGGG + Intronic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1059500354 9:114747153-114747175 AAAGCTAGCAAATGTCAGTCTGG - Intergenic
1059553917 9:115259354-115259376 ACAGCTAGTAAATGGCAGCATGG + Intronic
1059923053 9:119179181-119179203 AAAGCCAGTCAGTGTGAGGCAGG + Intronic
1060334353 9:122707309-122707331 ACAACTAGTAAGTGGCAGCTAGG + Intergenic
1060334384 9:122707521-122707543 ACAGCTAGTGATTGTAAGGCTGG + Intergenic
1060800320 9:126540479-126540501 ACAGCTACTAAGTGACTAGCGGG + Intergenic
1060829663 9:126705712-126705734 ACAGCTGGGAAGCGGCAGGCTGG + Intergenic
1060994930 9:127870555-127870577 ACAGCTGGTATGTGTGAGCCAGG + Intronic
1061177368 9:129005823-129005845 TCAGCTGGGAAGTGGCAGGCAGG - Intronic
1061474862 9:130858328-130858350 AAAGCTAGTATGTGCCAGGTGGG + Intronic
1061734497 9:132644475-132644497 ACAGCCAGCAAGTGACAGCCAGG + Intronic
1187246132 X:17554275-17554297 ACAGCTGTGAAGTGTCAGGGTGG + Intronic
1187437721 X:19287886-19287908 AGAGCTTGTAAATGTCACGCAGG - Intergenic
1187656306 X:21478699-21478721 ACAGCTAGTAAATGCCAGAATGG - Intronic
1188247913 X:27856550-27856572 ACAGCTAGTAAGTGACAGGATGG + Intergenic
1188483280 X:30655439-30655461 ACAGCTAGTAGCTGCCAAGCAGG + Intronic
1189055356 X:37693951-37693973 ACAGCTAGTATGTGTCAGGAAGG + Intronic
1189193872 X:39135311-39135333 AGAGCTAGGAAATGTCAGACTGG + Intergenic
1189665687 X:43352192-43352214 ACCGCCAGTAGGAGTCAGGCAGG - Intergenic
1190095778 X:47479249-47479271 ATAGCTAGTAAGTGCCAAGCAGG + Intronic
1190559668 X:51674364-51674386 ACAGCTAGTAAGTGGGATCCGGG + Intergenic
1190564623 X:51718957-51718979 ACAGCTAGTAAGTGGGATCCGGG - Intergenic
1190736861 X:53261308-53261330 ACAGCTGGTCAGTGGCAGTCAGG - Intronic
1192553681 X:72073242-72073264 ACAGCCAGTAAGGGTGAGGGTGG + Intergenic
1193459982 X:81778812-81778834 ACAGCCAGTAAGTGTCAAAGCGG + Intergenic
1194340947 X:92704876-92704898 CCAGCTAGTAAGTGACAGGCAGG - Intergenic
1195920071 X:109974761-109974783 ACATCTATAAAGTGTCAGGTTGG - Intergenic
1196694760 X:118599989-118600011 AGAGCTAGTAAGTGACATGTGGG - Intronic
1198036583 X:132807036-132807058 ACAGCTACTAAGTATTAGGTTGG + Intronic
1200649301 Y:5821595-5821617 CCAGCTAGTAAGTGACAGGCAGG - Intergenic
1201317318 Y:12660623-12660645 AAAGTTAGTAAGTATAAGGCAGG + Intergenic