ID: 1141051992

View in Genome Browser
Species Human (GRCh38)
Location 16:80775441-80775463
Sequence CAACCCACCCCCCTTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141051992_1141051993 4 Left 1141051992 16:80775441-80775463 CCTTTTTCAAGGGGGGTGGGTTG 0: 1
1: 0
2: 5
3: 14
4: 119
Right 1141051993 16:80775468-80775490 AATTAATTAATTCTAGACATTGG 0: 1
1: 0
2: 8
3: 60
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141051992 Original CRISPR CAACCCACCCCCCTTGAAAA AGG (reversed) Intronic
904512870 1:31028412-31028434 CAACCCACCCCCCCCGCCAATGG - Intronic
906046889 1:42838081-42838103 CAGACCACCCCCCTATAAAATGG + Intronic
908219445 1:61989644-61989666 CAACCCACCCGCACTAAAAAGGG - Intronic
909471244 1:76030739-76030761 CACCCTACCTCCCTTTAAAATGG - Intergenic
915505640 1:156354440-156354462 CAACCCTCTCCCCTTGCTAAAGG - Intronic
919629281 1:199944169-199944191 CAACCCATCCCCCAAAAAAAAGG + Intergenic
920303797 1:205006049-205006071 CAAACCAACCTCCTTGCAAAAGG + Intronic
924168604 1:241312574-241312596 AAACCCACACCCCTTTAAAATGG + Intronic
1067981155 10:51086603-51086625 CAACTCACCCCCTTAGAAAATGG + Intronic
1068782105 10:60930913-60930935 CAACCCAACCCCCTTAAAAAAGG - Intronic
1071514009 10:86285084-86285106 CAACCCACCCCCCATGGCCAGGG + Intronic
1074399016 10:113126584-113126606 CAACCCACCCCCCCACAAAAGGG - Intronic
1075418373 10:122282389-122282411 CCATCCTCCCCCCTTGGAAAGGG + Intronic
1075614266 10:123880148-123880170 CCACCCACCCTCCCTGAACAGGG + Intronic
1076571103 10:131433591-131433613 CATCCCACCCCCCTTCAGCAAGG - Intergenic
1077485413 11:2836242-2836264 CAAGCCACCCGCCTTGAATCTGG - Intronic
1078253511 11:9637951-9637973 CACCCCACCCACTATGAAAAAGG - Intergenic
1080191712 11:29558269-29558291 CAACCCCCCCCCTTTGATTATGG + Intergenic
1081094983 11:38921305-38921327 CCACTCACTCCCCTGGAAAATGG - Intergenic
1083171283 11:60925124-60925146 CAACCCACCCCCCTCGGGAGTGG + Intronic
1083636349 11:64122923-64122945 CAGACCCTCCCCCTTGAAAATGG + Intronic
1085850045 11:80109500-80109522 CCATCCACTCCCCTGGAAAAGGG + Intergenic
1086047162 11:82546806-82546828 CAACCTTCCCCCCTTGAATGGGG + Intergenic
1096101905 12:48974564-48974586 CAAACCACCCCCCTGGAATAGGG - Intergenic
1096555523 12:52401177-52401199 CAGCCCACCCACTCTGAAAAAGG - Intronic
1104099797 12:125596358-125596380 AAGCCCACCCCTCTTGACAATGG - Intronic
1105530030 13:21210896-21210918 TAACCCACCCCCCCTGAAAATGG + Intergenic
1112000324 13:95203817-95203839 CCTCACACCCCCCTTGAACAAGG + Intronic
1118304903 14:64647591-64647613 CCACCCATCTCCCTTGGAAAGGG - Intergenic
1126372706 15:47964142-47964164 AAACCCACTCCGCATGAAAAGGG + Intergenic
1126557079 15:50000527-50000549 CAAACCATCCCATTTGAAAATGG - Intronic
1127207023 15:56732254-56732276 CAACCCAGACCACTTCAAAAGGG + Intronic
1129208808 15:74053629-74053651 CCACCAACCCCCCTGGAGAAAGG + Intergenic
1130512608 15:84601650-84601672 CAACCCTCCCTCAATGAAAAGGG - Intronic
1133526652 16:6612084-6612106 CAACCCTCCCCTCTTGCATATGG + Intronic
1140311784 16:73856421-73856443 CAACCCCCACCCCTTGGCAAGGG + Intergenic
1141051992 16:80775441-80775463 CAACCCACCCCCCTTGAAAAAGG - Intronic
1142395884 16:89831262-89831284 CATCCCACCCACCTTGCACATGG - Intronic
1149504973 17:57186650-57186672 CACCCCACCCAGCTTGAAAGAGG - Intergenic
1149572038 17:57678780-57678802 CAACTCACCCCCTTCCAAAATGG + Intronic
1150790590 17:68198143-68198165 CACCGCACCCCCCCCGAAAAAGG - Intergenic
1151693848 17:75703971-75703993 GTACCCAGCCCCCTTGAACATGG - Intronic
1152486272 17:80595786-80595808 CACCCCACCCCCCTGACAAAGGG - Intronic
1153140824 18:1970834-1970856 CAACCCACCTGCCTGAAAAAGGG + Intergenic
1154023924 18:10689034-10689056 CAAAATACCCTCCTTGAAAAAGG - Intronic
1159116984 18:64125826-64125848 AAACCCACTCCCCCTGATAATGG - Intergenic
1159516049 18:69459097-69459119 CAACCCCCCCCCCAAAAAAAAGG + Intronic
1160621239 18:80172351-80172373 CAACCCAACCCAGTTGAAAATGG - Intronic
1160621338 18:80173312-80173334 CAACCCAACCTGCTTGGAAAGGG + Intronic
1163193761 19:15699108-15699130 CACCTCACCCCCATTGAAAAGGG - Intergenic
1163193929 19:15701408-15701430 CATCTCACCCCCATTGAAATGGG + Intergenic
1164891966 19:31831485-31831507 CAACCCACCCCCAGTCACAAAGG + Intergenic
925532486 2:4880168-4880190 CTACCCGCCCCCCATGAAAATGG + Intergenic
925872558 2:8283834-8283856 CAAATCACCCACCTTTAAAAAGG - Intergenic
926162016 2:10495864-10495886 CATCCCACCCCCCTTTATGATGG + Intergenic
926409656 2:12589962-12589984 CCACCTCCCCCCCTTGCAAAGGG + Intergenic
926468559 2:13223172-13223194 CAACATACACACCTTGAAAATGG - Intergenic
927087935 2:19689600-19689622 CAACCCAACCCCCTTTCACAAGG - Intergenic
927971716 2:27309806-27309828 CAACCCAACCCCGTGGAAACTGG + Exonic
930015208 2:46965346-46965368 CAGCCCACACCCCTTGGAGAGGG - Intronic
932057932 2:68466273-68466295 CAACCAACCCCCGTTATAAAAGG - Exonic
934784874 2:96997733-96997755 CACCCCACTCACCTTGTAAATGG - Intronic
935548235 2:104423522-104423544 CCAGCCACCTCCCTTGAAAAGGG + Intergenic
938577597 2:132619081-132619103 GAACCCAGCACCCTGGAAAAGGG - Intronic
946404707 2:219486224-219486246 CACCCCATCCCCCCTGAAAAAGG + Intronic
948224223 2:236296381-236296403 ACACCCACCCCCCTTCAAACAGG + Intergenic
948246518 2:236490361-236490383 CAACCCACTACCCTTCAACATGG + Intronic
1172491164 20:35339093-35339115 CTACCCTCCCCCTTTGAAAAAGG - Intronic
1173256115 20:41395258-41395280 CATCCCTCCCGCCTGGAAAAAGG - Intergenic
1178544497 21:33481345-33481367 CAACCCCCGCCCCTTTCAAAAGG - Intergenic
1180936329 22:19627532-19627554 CAAACCACCCAGCTTGACAAGGG - Intergenic
1181041407 22:20194342-20194364 CAACCCATCCCCCTGGACATGGG + Intergenic
1181573081 22:23778421-23778443 CCACCCTCCCCGCTTGAAGAAGG + Intronic
1182550330 22:31097404-31097426 CAGCCCACCCCTCTGTAAAACGG - Intronic
1184449162 22:44572774-44572796 CAACCCAGCCCCGGTGAAACGGG + Intergenic
949904146 3:8844386-8844408 CAAGCCCTCCCCCTTGATAAAGG - Intronic
951708831 3:25569600-25569622 TAACACACCTCCCTGGAAAAGGG - Intronic
955125409 3:56106158-56106180 CCACCCACCCCCAGTGCAAAAGG - Intronic
960842013 3:121968884-121968906 CAACCAACCCAACTTTAAAATGG - Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967296754 3:187972987-187973009 AAACCCACCCTCTTTGGAAAGGG + Intergenic
967380656 3:188853961-188853983 GAACCCACACTGCTTGAAAAAGG - Intronic
970622355 4:17836292-17836314 CAACCAACCCAACTTAAAAATGG - Intronic
978750551 4:112241557-112241579 CAACCCACCCACCTTGGAAAGGG + Intronic
990822348 5:59856911-59856933 CAACCCACCCACTTGGTAAAAGG + Intronic
991660184 5:68943158-68943180 AGACCCAACCTCCTTGAAAAAGG + Intergenic
992942644 5:81777569-81777591 CTACCTACCCCCATGGAAAATGG + Intergenic
996919988 5:128756837-128756859 GAACCCCCCTCCCATGAAAATGG + Intronic
997816515 5:137024305-137024327 CTACCCCCCCCCCTTCAAACTGG - Intronic
1000912705 5:167041791-167041813 CAAACCTCCCCCCTCCAAAAGGG + Intergenic
1001412948 5:171523758-171523780 CAACCCACCCCCTCGGAGAAGGG - Intergenic
1003331949 6:5136348-5136370 CAACCCAGCCCCAGTCAAAAAGG - Intronic
1003401980 6:5797992-5798014 TAACCCACCCCCCCTGAAAATGG - Intergenic
1003704996 6:8516002-8516024 CTTCCCCCACCCCTTGAAAATGG - Intergenic
1003951914 6:11124490-11124512 CCACCTACCCCCCTAAAAAAAGG - Intronic
1008936265 6:56995934-56995956 CAACTCTCCATCCTTGAAAAAGG + Intronic
1008991243 6:57604542-57604564 CAAACCATTCCCCTTGAGAATGG - Intronic
1009179770 6:60502779-60502801 CAAACCATTCCCCTTGAGAATGG - Intergenic
1009884124 6:69604083-69604105 CCTCCCAACCCCCTTGAAGACGG - Intergenic
1010295873 6:74194974-74194996 CCACACACACCCCTAGAAAAGGG - Intergenic
1010399087 6:75427969-75427991 CAACCCACCCTCTTTAAAAATGG - Intronic
1012998569 6:105997636-105997658 CAACCTACTTCCCTTAAAAAAGG - Intergenic
1017907866 6:158769237-158769259 CAACCCACCCACCTGCAGAAGGG + Intronic
1023807584 7:43884538-43884560 CACCCCACCTGGCTTGAAAATGG - Intronic
1025149829 7:56539461-56539483 CAGCCCATCCCCCTTGGAGAGGG + Intergenic
1025260190 7:57413392-57413414 CAGCCCACCCCCCTTGGGAAGGG + Intergenic
1026151929 7:67795181-67795203 CAACACTCCACCCTTGAAAAAGG - Intergenic
1028696978 7:93725570-93725592 CAAACCACCACCCTGAAAAATGG + Intronic
1029788230 7:102815172-102815194 CAATCCAGCCTCCTTGGAAATGG + Intronic
1030754971 7:113276351-113276373 AAACCCAGCCCCATTAAAAACGG + Intergenic
1032482030 7:132254982-132255004 CAGGCCACCCCCCCTGAGAATGG - Intronic
1034473840 7:151271208-151271230 CACCCCACCCGCCTGGGAAAGGG - Intronic
1037463394 8:19135805-19135827 CACCCCTCCCACCATGAAAAGGG - Intergenic
1038410947 8:27359499-27359521 CAAGCAACCCACCTTGAGAAAGG - Intronic
1039125086 8:34192088-34192110 AAAAACACCCCCCATGAAAAGGG - Intergenic
1041081947 8:54222462-54222484 CTACCCTCCCCCATGGAAAATGG + Intergenic
1044768409 8:95602701-95602723 CAACCCACCACATTTAAAAAAGG + Intergenic
1049197604 8:141324277-141324299 AAACCCACCCACCTTAAACATGG + Intergenic
1049280718 8:141742768-141742790 CCCTCCACCCCACTTGAAAAAGG + Intergenic
1049645993 8:143735835-143735857 CTACCCACCCCCCAGGAGAATGG + Intergenic
1050711893 9:8474697-8474719 CAAACCACCCCACTAGAAGATGG + Intronic
1051159277 9:14187940-14187962 CAACCCACCCCCCACAACAATGG + Intronic
1052360740 9:27553858-27553880 CAACCCACCCCACTACAAACTGG + Intronic
1055444663 9:76370710-76370732 CAACCCAACCTCCTTGAAGTTGG + Intergenic
1056804672 9:89719403-89719425 TAACCCTCCTCCCTTGAATACGG + Intergenic
1057016689 9:91658359-91658381 AAACCCAGCCCCCTTGAGCAGGG + Intronic
1058155067 9:101505786-101505808 CTACCCACCCCCTTTGTAAATGG + Intronic
1059876296 9:118639034-118639056 AAACACAACCCCCTTAAAAATGG - Intergenic
1062448247 9:136604703-136604725 AAACCCCCTCCTCTTGAAAATGG - Intergenic
1185725100 X:2413236-2413258 CAACCCACCCCCCTAGCACCTGG - Intronic
1186076781 X:5888247-5888269 GAACACATCCCCCTTGGAAAAGG - Intronic
1186096729 X:6110396-6110418 CAGCCCAGCCCCCTTGCAATTGG - Intronic
1186791972 X:13008422-13008444 CAACCCTCCTTCCTTGAAGATGG - Intergenic
1188306254 X:28562925-28562947 CAAGCCACCCCTTTTTAAAAAGG - Intergenic
1197290681 X:124653532-124653554 CAACCCATCACCCTTGAAAAGGG + Intronic
1198089875 X:133318044-133318066 TAAGTCAACCCCCTTGAAAAGGG + Intronic
1198738332 X:139812373-139812395 CACCCCACTCCCCTTTACAAAGG - Intronic
1201502423 Y:14659731-14659753 CAGCCCAGCCCCCTTGCAATTGG + Intronic
1201563616 Y:15343853-15343875 CCACTCACTCCCCTGGAAAAGGG - Intergenic