ID: 1141053590

View in Genome Browser
Species Human (GRCh38)
Location 16:80795469-80795491
Sequence GGTCACACCACTCCAGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141053590_1141053594 5 Left 1141053590 16:80795469-80795491 CCTTTCACTGGAGTGGTGTGACC 0: 1
1: 0
2: 2
3: 8
4: 104
Right 1141053594 16:80795497-80795519 AGGTAGCAGCTTCTACTCGCTGG 0: 1
1: 0
2: 1
3: 7
4: 80
1141053590_1141053595 11 Left 1141053590 16:80795469-80795491 CCTTTCACTGGAGTGGTGTGACC 0: 1
1: 0
2: 2
3: 8
4: 104
Right 1141053595 16:80795503-80795525 CAGCTTCTACTCGCTGGCTAAGG 0: 1
1: 0
2: 0
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141053590 Original CRISPR GGTCACACCACTCCAGTGAA AGG (reversed) Intronic
900805248 1:4763292-4763314 GGTCACAACAACACAGTGAAGGG - Intronic
903542895 1:24106922-24106944 GGTCACACCACTGGAATGTAGGG + Intronic
905075140 1:35264079-35264101 GGTCAGAGCATTCCAGTCAAAGG - Intergenic
909203709 1:72725900-72725922 GGTCACTACACTCCAATGGATGG - Intergenic
910657154 1:89631464-89631486 GGTCACAACCCTCCTGTGGAGGG - Intergenic
911311529 1:96297842-96297864 GGTCACTACACTCCAATGAGTGG + Intergenic
911546613 1:99224999-99225021 GGTCACACAAATACATTGAAGGG + Intergenic
913546160 1:119871213-119871235 GGTCACACCATTCCAGGGAGCGG + Intergenic
914196120 1:145448891-145448913 GGCCACCCCACCCCAGTGGAAGG + Intergenic
920578038 1:207077372-207077394 GGTCACAGATATCCAGTGAAAGG - Exonic
922071905 1:222203296-222203318 GTTCACACAACTCCAGTCTAGGG - Intergenic
1066176282 10:32910790-32910812 GGTCACACCACTGCACTGCCTGG - Intronic
1079086716 11:17451233-17451255 CCTCACACCCCTCCAGTGACAGG - Intronic
1083266210 11:61548110-61548132 GGTCACCCCACTCCCCTGAAAGG + Intronic
1083324461 11:61866345-61866367 GGTCAGAGCACTCTAGTGATGGG - Exonic
1084925768 11:72510331-72510353 GGCCACAACACTCCAATGAGTGG + Intergenic
1086167983 11:83801571-83801593 GGTAAGAGCACTCCAGTCAAAGG - Intronic
1090163242 11:124517573-124517595 GTTCCCACCTCTCCAGAGAAGGG - Intergenic
1093490789 12:19701519-19701541 GGCCACAACACTCCAATGAAGGG - Intronic
1104318723 12:127729347-127729369 GGTCGCACCACTGCAGCGACTGG + Intergenic
1111019259 13:82425357-82425379 GGCCACATCACTCCAGTTCAAGG + Intergenic
1113892645 13:113744391-113744413 GCTCCCCCCACTCCAGGGAATGG + Intergenic
1117668726 14:58083606-58083628 GGTGCCAGCACTCCATTGAAAGG - Intronic
1119575406 14:75716635-75716657 GGGAAAACCACTCTAGTGAAGGG + Intronic
1121472457 14:94165958-94165980 GGTGAGACCATTCCAGTGCAAGG + Intronic
1124288299 15:28424639-28424661 GGTCACACCACTCCAGCCTGGGG - Intergenic
1124294924 15:28492675-28492697 GGTCACACCACTCCAGCCTGGGG + Intergenic
1126101728 15:45121993-45122015 GGTGACACCTCTCCAGGCAAGGG + Intronic
1129931270 15:79412806-79412828 GGTCACAACACTCCAATGGGTGG - Intronic
1132042372 15:98536119-98536141 GGCCACAACACTCCAGTGGGGGG - Intergenic
1133203375 16:4218203-4218225 GGTCACCTCACTTCAGTGACTGG - Intronic
1139260565 16:65589589-65589611 AGACACACCAATCCAGTGCAGGG + Intergenic
1141053590 16:80795469-80795491 GGTCACACCACTCCAGTGAAAGG - Intronic
1142659971 17:1421859-1421881 GGTCATACCACACCAGAGACCGG + Exonic
1147261652 17:39212521-39212543 GGTCCCATCACTCCAGCAAAGGG - Intronic
1148254985 17:46122865-46122887 GTTCTCACTACTCCACTGAATGG + Intronic
1150722462 17:67625309-67625331 GTTCACAGCACTCCAGTGTCAGG + Intronic
1155844958 18:30694840-30694862 GGTCACAACACTCCAGTGGATGG + Intergenic
1158052814 18:53243754-53243776 GGTCACTCAACTGAAGTGAAGGG + Intronic
1163265225 19:16216835-16216857 GGTCACAACACTCCAATGGGTGG + Intronic
1164485788 19:28654765-28654787 GGTCACATTGCTCCAGAGAAGGG + Intergenic
1164737154 19:30550185-30550207 GGTCACACCACTACTGTTCAGGG - Intronic
1166741269 19:45116302-45116324 GGCCTGCCCACTCCAGTGAAGGG - Intronic
925304913 2:2841297-2841319 GGACATACCACTCCAATGTATGG + Intergenic
927391710 2:22603520-22603542 GGTCAAACAACTCAAATGAAAGG + Intergenic
933173712 2:79154525-79154547 GGCCACAACACTCCAGTAAGTGG + Intergenic
935000384 2:99008812-99008834 GTGCACACTACTCCAGTGTATGG - Intronic
936812110 2:116414176-116414198 GGCCACAACACTCCAGTGGGTGG - Intergenic
937375956 2:121335823-121335845 GGTCACAGGCCACCAGTGAAGGG - Intergenic
946080509 2:217114475-217114497 AGTAACACAACTTCAGTGAAAGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1174482762 20:50842821-50842843 GGTGACACCTTTCCTGTGAAGGG - Intronic
1179172142 21:38981049-38981071 GCTCCCACCTCTCCTGTGAAGGG - Intergenic
1179635710 21:42707400-42707422 GGTCAGTCCTCCCCAGTGAAAGG + Intronic
1181265352 22:21627993-21628015 GCTCAAACCACTCCAGGAAATGG - Intergenic
952821966 3:37493645-37493667 GGTCACACAGCTCTAGTAAATGG - Intronic
954412920 3:50378930-50378952 CGTCACACCGCTGCAGTGGATGG - Exonic
954777041 3:53028835-53028857 GTTCACACCAAGCCAGTGACAGG - Intronic
954940414 3:54367299-54367321 AGGCAGACCACTCCTGTGAATGG + Intronic
956114449 3:65904411-65904433 GCTAAAACCCCTCCAGTGAATGG + Intronic
958914936 3:100039179-100039201 GTTTTCACCACTACAGTGAAAGG - Intronic
959465695 3:106683860-106683882 TCTCACACCCCTCCAGTAAATGG - Intergenic
961346947 3:126269097-126269119 GGTCACACCACACTGGGGAATGG - Intergenic
966941071 3:184747518-184747540 GGTCACACCAATCCAGTCTCTGG + Intergenic
968211077 3:196849277-196849299 GGTTACACCACTCCAGAGCGGGG + Intergenic
968540463 4:1165701-1165723 GGACACAACACTCCAGTCAAAGG - Intergenic
969485849 4:7472066-7472088 GGTCACAGCCCCCCAGTGCAGGG - Intronic
970871865 4:20825650-20825672 GGACACACAGCTCCAGTGAGAGG + Intronic
973849731 4:54949071-54949093 GGTCACACCACTCCAATCATTGG + Intergenic
987771699 5:22313866-22313888 ATGCACACCACTCCAGTGACAGG + Intronic
989158270 5:38365581-38365603 GGCCACAGCACTTCAGTGAGTGG + Intronic
994643002 5:102433662-102433684 GGTCACAACACTCCAATGGACGG + Intronic
995488070 5:112659053-112659075 GGCCACAACACTCCAATGAGTGG - Intergenic
998544961 5:143019653-143019675 GAACACACCAGTCCAGTGCAAGG + Intronic
999079405 5:148828651-148828673 GGCAACAGCACTCCAGTCAAGGG - Exonic
1003161964 6:3643865-3643887 AGTCACATCTCTGCAGTGAATGG + Intergenic
1004058847 6:12170743-12170765 GGTCAGAGCACTACAGGGAAAGG + Intergenic
1004834100 6:19511426-19511448 GGTCACTACACTCCAATGAGTGG + Intergenic
1005974940 6:30790785-30790807 GTTCCCACCCCTCCTGTGAAAGG + Intergenic
1006253064 6:32807121-32807143 GGTCACTACACTCCAATGAGTGG + Intergenic
1010346034 6:74811683-74811705 GATAACACCACTACAGGGAAAGG - Intergenic
1022378292 7:29835700-29835722 CCTCACACCACTTCAGTGAGGGG + Intronic
1022542697 7:31153370-31153392 GATCACACCACTGCACTCAATGG - Intergenic
1022877877 7:34553345-34553367 GGTCACAACACTCCAATGGGTGG - Intergenic
1024356843 7:48422353-48422375 GGTCACAGCACTCCAGTCAAAGG - Intronic
1025781412 7:64605065-64605087 AGTCACATCACTTCAGTGATAGG - Intergenic
1026330610 7:69349225-69349247 GGTTACACTTCTGCAGTGAATGG - Intergenic
1029605339 7:101595689-101595711 GATCACACCACTGCAGTGTGAGG - Intergenic
1031712636 7:125068198-125068220 GGTCACACGAATGCATTGAAGGG + Intergenic
1034366360 7:150551887-150551909 GGTAACAACACTCCAATGAGTGG - Intergenic
1035124925 7:156601636-156601658 GGCCCCAACACTCGAGTGAAGGG + Intergenic
1037155566 8:15694822-15694844 GGTCACAACACTCCCATGAGTGG + Intronic
1037560715 8:20072360-20072382 GATCACACCCCACTAGTGAAGGG + Intergenic
1042413473 8:68491948-68491970 GGTCACACCACCCTACTGGAGGG - Intronic
1044087487 8:87958322-87958344 GTACACACCACTCCAGAGAAAGG - Intergenic
1044822342 8:96162738-96162760 GGTCACACTACTCCAGAGTCTGG + Intergenic
1047305302 8:123648243-123648265 GGTCATACAACTACAGTGAGTGG + Intronic
1048029396 8:130616682-130616704 GGTCACTACACTCCAATGGATGG - Intergenic
1051594999 9:18816281-18816303 GGTCACACCACTGCACTCCAGGG - Intronic
1052130832 9:24844899-24844921 GGTCTCTGCACTCCAGTTAAGGG - Intergenic
1055316663 9:75040808-75040830 GGTTACAGCACTTGAGTGAAGGG - Intergenic
1057218166 9:93241016-93241038 GGTCACACCCCTGCAGGGATAGG + Intronic
1058813249 9:108661163-108661185 AGTCACACCACAGAAGTGAAAGG - Intergenic
1061179045 9:129013324-129013346 GGCCACACCACTGCAATGACAGG + Intronic
1062698612 9:137887944-137887966 GGCCACCCCACCCCAGTGGAAGG - Intronic
1189351961 X:40282226-40282248 GCTCAGCACACTCCAGTGAAAGG + Intergenic
1189558035 X:42165636-42165658 GGTCACAACACTCCAATGGGTGG + Intergenic
1191817772 X:65266865-65266887 GGTCACAGCACACCAGGGCAAGG + Intergenic
1195066893 X:101245303-101245325 GTGCACACCACTCAAGTGACAGG - Intronic
1195968586 X:110451131-110451153 GTACACACCACTCCAGAGGATGG - Exonic
1196584177 X:117409876-117409898 GGTCACAGCACTCCAATGGGTGG - Intergenic
1197820961 X:130540520-130540542 GGTCTCACAACTCCAAAGAAAGG - Intergenic
1199707089 X:150437126-150437148 GGTCACAACACTGCAATGGATGG + Intronic
1201968276 Y:19762536-19762558 GGTCACAACACTCTAATGATTGG + Intergenic
1201982162 Y:19919562-19919584 GGGAACACCACTGCAGTGAATGG - Intergenic