ID: 1141054221

View in Genome Browser
Species Human (GRCh38)
Location 16:80802341-80802363
Sequence GTTTAGGGGTGAAAGTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141054221_1141054225 13 Left 1141054221 16:80802341-80802363 CCAGATCACTTTCACCCCTAAAC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1141054225 16:80802377-80802399 AGCCAATGTCCCCACAGTACTGG 0: 1
1: 0
2: 0
3: 10
4: 98
1141054221_1141054230 25 Left 1141054221 16:80802341-80802363 CCAGATCACTTTCACCCCTAAAC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1141054230 16:80802389-80802411 CACAGTACTGGTTACACATAAGG 0: 1
1: 0
2: 0
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141054221 Original CRISPR GTTTAGGGGTGAAAGTGATC TGG (reversed) Intronic
905396418 1:37669475-37669497 GTTGAAGGGTGAAAGAGATGAGG - Intergenic
905899428 1:41571472-41571494 GTTCAGGTGTGGAAGTGATGGGG + Intronic
907277530 1:53325621-53325643 GGTTAGGTCTGAAAGTGAACGGG + Intronic
911371859 1:97003536-97003558 GTTTAGGAGTGATAGTGCTGTGG + Intergenic
915751472 1:158214228-158214250 TTTAAGGGGTGAAAGTGTTACGG - Intergenic
916070340 1:161166335-161166357 TTTTATTGGTGAACGTGATCCGG + Intergenic
921193141 1:212727125-212727147 GTTTAGGAGAGAAGGGGATCGGG - Intronic
921234040 1:213106384-213106406 GTTTAGGTGTGAAAGGGAAAAGG + Intronic
921732178 1:218590895-218590917 GTTGAGACGTGAAAGTGACCAGG + Intergenic
924258085 1:242202481-242202503 TTTTAGGGCTGAAAGTGGTCTGG - Intronic
924553207 1:245097689-245097711 GATAAGGGGTGAGAGTGATGGGG + Intronic
1063153802 10:3359859-3359881 TTTTAGGGATGAAGGTAATCAGG + Intergenic
1064048686 10:12042430-12042452 GTGGAGGGGCGAAAGTGTTCGGG - Intronic
1064268673 10:13846440-13846462 GCTTGGGGGTGAAGGTGATGGGG + Intronic
1066123797 10:32318983-32319005 ATTCAGGGGAGAAAGTGGTCAGG - Intronic
1068777709 10:60886010-60886032 GTTTAAGGATTAAAGTCATCTGG + Intronic
1068886167 10:62099085-62099107 TTTTAGGGCTGATAGTGACCAGG + Intergenic
1070420155 10:76228508-76228530 GTAAAGGGGTAAAGGTGATCAGG + Intronic
1073912363 10:108360963-108360985 GGTTAGGTGGGAAAGAGATCAGG - Intergenic
1074784004 10:116822813-116822835 GTCTAGGAGTGAGAGTGATTTGG - Intergenic
1078058214 11:8024891-8024913 ATTTTGGGGTCAAAGTGACCTGG + Intronic
1079795382 11:24796177-24796199 TTTTAGGGGTCAAATTGCTCTGG + Intronic
1082752159 11:57031031-57031053 GGTTAGGGGTGGAATTGTTCTGG - Intergenic
1089547048 11:119236164-119236186 GTTGGGGGGTGAAAATGTTCTGG - Intronic
1090558222 11:127899103-127899125 GTTCAGAGGTGACAGTGAGCTGG - Intergenic
1091684752 12:2553747-2553769 GTTAAAGGGTGAGAGTGATGGGG + Intronic
1098990076 12:77056241-77056263 GTTTAGGGCTGAAAAGTATCAGG + Intronic
1102495649 12:113317072-113317094 GTTTAGGGGTGCAAGTGTTCAGG + Intronic
1102527057 12:113519841-113519863 GTTAAGGGGCGAAAGTCCTCAGG + Intergenic
1104079331 12:125416484-125416506 GTTTAGGGAAGAAAGAGAACTGG - Intronic
1106037415 13:26056598-26056620 CTTTTGGGGTGAAAATGTTCTGG + Intergenic
1107204722 13:37770040-37770062 TTTCAGGGTTGAAAATGATCAGG - Intronic
1113072032 13:106431404-106431426 GTTAAGGGGTGATGGTGAGCTGG + Intergenic
1113568870 13:111339293-111339315 GTTTAGGGGAGGAATTGACCTGG + Intronic
1116054018 14:39840280-39840302 GATTAGAGGTGCAAGAGATCTGG - Intergenic
1117106095 14:52398389-52398411 GTTGAGGGGTGAAGGTGAGGAGG - Intergenic
1118165151 14:63328786-63328808 GGTGTGGGGTGAAAGTGATCAGG - Intergenic
1118430106 14:65709545-65709567 GGGTAGGGGTGAGAGTGAACAGG + Intronic
1124941848 15:34225530-34225552 TTTTAGGGGTCGAAGTGACCGGG + Exonic
1126948521 15:53852609-53852631 GGCAAGGGGTGAGAGTGATCTGG - Intergenic
1128805768 15:70529913-70529935 GTTTTGGGGTGAAGTTAATCCGG - Intergenic
1129035215 15:72644990-72645012 GTGTAGTGGTGAGAGTGTTCTGG - Intergenic
1129214669 15:74092226-74092248 GTGTAGTGGTGAGAGTGTTCTGG + Intergenic
1129538507 15:76333211-76333233 GTTTTGGGGAGAAAATAATCAGG + Intergenic
1140880276 16:79191908-79191930 GTTTAAGGGAGCAAGAGATCAGG + Intronic
1141054221 16:80802341-80802363 GTTTAGGGGTGAAAGTGATCTGG - Intronic
1142911965 17:3101767-3101789 GTTTTGGGGTGGAAATGATGGGG - Intergenic
1144841219 17:18187197-18187219 GTTTAGGGGAGGAAATGAACTGG + Intronic
1147040980 17:37718855-37718877 GTCTAAAGGTGAAAGTGATGTGG - Intronic
1147899226 17:43773075-43773097 GTTGGGGGGTGACAGTGACCAGG + Intronic
1148462953 17:47848525-47848547 GGTTAGGAGGGAAAGTGAGCTGG - Intronic
1151633184 17:75325415-75325437 GTTCAGGTGTGAAAGGGAGCGGG - Intronic
1152287153 17:79419615-79419637 GTTTAGAGGTGAACGTGCTGAGG - Intronic
1153276406 18:3372100-3372122 GTAAAGGGGTGAAAGGGATGGGG + Intergenic
1153543298 18:6180337-6180359 GTTTAGGAGTCACAGTCATCTGG - Intronic
1154995780 18:21638950-21638972 GGTTAAAGGTGAAAGTGACCGGG - Intergenic
1157950306 18:52029200-52029222 GTTCAGGGGAGAAAGCAATCAGG + Intergenic
1158251612 18:55494622-55494644 GTTTAAGGATGCAAGTCATCAGG + Intronic
1159492780 18:69159912-69159934 ATTTAGGGGTGCAAATGATGAGG - Intergenic
1160536358 18:79596570-79596592 GTTTAGCAGTGAAACTGCTCCGG + Intergenic
1164848985 19:31463853-31463875 GTTTAGGTGTGAAGTTGAACTGG - Intergenic
1165282285 19:34807609-34807631 GTTTAGGGGTGAAGATGGTCAGG - Intergenic
933415331 2:81980381-81980403 TTTTTGGGGTGATAGTGATTTGG - Intergenic
935114256 2:100121014-100121036 GTTTAGGTGTGAAGGTGAAAAGG + Intronic
937657528 2:124393659-124393681 GTTTTGGGGTGCAGGAGATCTGG - Intronic
939144271 2:138394047-138394069 ATTTAGAGGAGAAAGTGATGAGG - Intergenic
941199200 2:162488553-162488575 TTTTAGGAGGGAAAGAGATCTGG - Intronic
941865370 2:170328739-170328761 ATTTAGGTATGAAAGTGATATGG + Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
944935229 2:204560905-204560927 GTTTAGGGGGCAAAGTAATTAGG + Intronic
945180784 2:207088903-207088925 CTGTGGGGGTGAAAGTGCTCCGG - Intronic
1172084041 20:32364708-32364730 TTTTAGAGCTGAAAGTGATGAGG + Intronic
1172207641 20:33175646-33175668 GCCTAGTGGTGAAAGTGTTCAGG + Intronic
1172628229 20:36360855-36360877 GTTTAGGGGAGAAGGGGATGAGG + Intronic
1173675526 20:44831755-44831777 GTTTTGGAGTTAAAGAGATCAGG - Intergenic
1179128196 21:38611196-38611218 GTTGAGGGGTGACAGTGGCCTGG - Intronic
1182049648 22:27302976-27302998 GTTTAGGGGACAAAGGGACCTGG - Intergenic
950499733 3:13355990-13356012 GTTTAGGGGTGGAACTCAGCTGG + Intronic
952622947 3:35367985-35368007 GGTCATGGGTGAAAGTGCTCTGG - Intergenic
955408637 3:58641907-58641929 ATTTAGGGGAGAAAGTCAGCAGG + Intronic
956971041 3:74526006-74526028 GTTTAGGTGTGAGAATGATTTGG + Intergenic
958894280 3:99812940-99812962 GTTTAGGGGGTAAAATGATGAGG - Intergenic
966645127 3:182237676-182237698 GTTTTGGGGTAAAAGAGATCTGG - Intergenic
970347634 4:15169031-15169053 GTTTAGGAGTGAAAGTGTGGAGG - Intergenic
983236909 4:165189865-165189887 ATTCAGAGGTGAAAGAGATCAGG - Intronic
983294857 4:165853917-165853939 GTTCAGGTGTGAAAGAAATCAGG - Intergenic
983641202 4:169945381-169945403 GTTTAGGGGTGAAGGTGGTGGGG + Intergenic
992679635 5:79141148-79141170 GTTTAGGGGTTGAGGGGATCGGG - Intronic
993215193 5:85013527-85013549 ATTTAGAGGTTAAAGAGATCTGG + Intergenic
995244589 5:109921695-109921717 GCTCAGGGGTGAATCTGATCAGG + Intergenic
997531475 5:134584077-134584099 GTCTAGGGGTGAAGGGGTTCAGG + Intergenic
998978326 5:147672862-147672884 ATTTAGGGGTGTAATTAATCAGG - Intronic
1002573389 5:180156997-180157019 ATTTGGTGGTGACAGTGATCTGG - Intronic
1003253570 6:4454989-4455011 CTTTGGGGGTGAAAGAGAACTGG - Intergenic
1003253578 6:4455032-4455054 CTTTGGGGGTGAAAGAGAACTGG - Intergenic
1006990804 6:38213167-38213189 TTTTAGGTATGAAATTGATCAGG - Intronic
1014053171 6:116980305-116980327 GTCTAGGAGTGAAAAAGATCAGG - Intergenic
1014809344 6:125868539-125868561 GTTTAGGGGTCAAAATGAGCTGG - Intronic
1027199437 7:76053905-76053927 GTGATGGGGTGAAAGTGACCCGG - Intronic
1028088931 7:86673064-86673086 GTTTAGGGCTCCAGGTGATCTGG + Intronic
1028937179 7:96479032-96479054 GTTTGGGGGTCAAAGAGATTTGG + Intergenic
1030400823 7:109047757-109047779 GTCTATGTGTGAGAGTGATCGGG + Intergenic
1031692431 7:124805480-124805502 GTTTAGGTGTGAAATTCCTCAGG - Intergenic
1032826240 7:135571385-135571407 GTTTAGGGGTACATGTCATCAGG - Intronic
1033601084 7:142888823-142888845 GTTTTGGGGTGAAGGTGGTGAGG + Intergenic
1034112635 7:148553039-148553061 GATTAAGGGTGGAAGTGGTCCGG - Intergenic
1036003156 8:4631747-4631769 GGTTAGAGGTGAATGTGATAGGG - Intronic
1039218313 8:35298302-35298324 GTTTAGGGGTGAAGTGGATAGGG - Intronic
1041059922 8:54025313-54025335 GTTGAGGGGAGAAAGGAATCAGG - Intergenic
1042599272 8:70482008-70482030 GTTTAAGGGTGAAAGAGAGAAGG - Intergenic
1044230892 8:89776562-89776584 GTTTGGGGATGACAGTGAACAGG + Intronic
1044842509 8:96349024-96349046 TTTTAGAGTTGAAAGGGATCTGG - Intergenic
1048300434 8:133247452-133247474 GTTAAGGGGTGAAAGGAGTCAGG + Intronic
1051948754 9:22604520-22604542 GTTTAGGGGAGAATGGTATCAGG + Intergenic
1056024551 9:82479637-82479659 GCTGAGGGGTGAAAGGCATCAGG + Intergenic
1057022778 9:91713397-91713419 GTTTACAAGGGAAAGTGATCTGG - Intronic
1057914956 9:99048233-99048255 GAGTAGGGGAGAAAGGGATCTGG + Intronic
1059857402 9:118415167-118415189 GATTAGTGGTCAAAGCGATCAGG + Intergenic
1202629922 M:8125-8147 GTGTAGCGGTGAAAGTGGTTTGG - Intergenic
1188360428 X:29246340-29246362 CTTTAGGGGTCACAGTGATGAGG + Intronic
1189303387 X:39969210-39969232 GGTTAGGGTTGAAGGTGATCAGG - Intergenic
1189530406 X:41875485-41875507 GGTTATGGGTGAAAGTGAAATGG - Intronic
1190180884 X:48191379-48191401 GTTTAGAGGGTAAAGGGATCTGG - Intronic
1190193926 X:48300847-48300869 GTTTAGAGGATAAAGGGATCTGG - Intergenic
1190209351 X:48432416-48432438 GTTTAGAGGGTAAAGGGATCTGG + Intergenic
1190218188 X:48493773-48493795 TTTTTGGGGTGAAGCTGATCAGG - Intergenic
1190660438 X:52649506-52649528 GTTTAGAGGGTAAAGGGATCTGG - Intronic
1190663159 X:52673605-52673627 GTTTAGAGGGTAAAGGGATCTGG + Intronic
1190676264 X:52784877-52784899 GTTTAGAGGGTAAAGGGATCTGG - Intronic
1192811167 X:74548554-74548576 GTTTAGGGGTTAAGGGGATAAGG - Intergenic
1199970043 X:152852961-152852983 GTTTAGAAATGATAGTGATCAGG - Intronic