ID: 1141054377

View in Genome Browser
Species Human (GRCh38)
Location 16:80803303-80803325
Sequence ACTCATTAGGACCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141054373_1141054377 -8 Left 1141054373 16:80803288-80803310 CCAACGCTGGCCACTACTCATTA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1141054377 16:80803303-80803325 ACTCATTAGGACCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 116
1141054371_1141054377 18 Left 1141054371 16:80803262-80803284 CCACTTTTGGGAAGACATGAGAG 0: 1
1: 0
2: 3
3: 17
4: 182
Right 1141054377 16:80803303-80803325 ACTCATTAGGACCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 116
1141054370_1141054377 24 Left 1141054370 16:80803256-80803278 CCTTCGCCACTTTTGGGAAGACA 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1141054377 16:80803303-80803325 ACTCATTAGGACCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141054377 Original CRISPR ACTCATTAGGACCTGGAGCC AGG Intronic
902364358 1:15961772-15961794 TCTTACTAGGACCAGGAGCCAGG - Intronic
902610150 1:17592436-17592458 TCTCATTGGGGCCTGGAGCCAGG + Intronic
903770097 1:25758422-25758444 CCTCATCAGGACATGGGGCCAGG + Intronic
904644951 1:31958646-31958668 CCTCATCATGACCTGAAGCCTGG + Intergenic
913526503 1:119698683-119698705 ACTGAATAGGCTCTGGAGCCTGG + Intronic
921261639 1:213389613-213389635 GCACATGGGGACCTGGAGCCCGG - Intergenic
922543362 1:226435465-226435487 ACACATCAGTACCTGGGGCCAGG - Intergenic
1064193687 10:13228634-13228656 ATGGAGTAGGACCTGGAGCCAGG + Intronic
1066200789 10:33141198-33141220 ACTCATTATGCCCTCGATCCAGG - Intergenic
1067519068 10:46981400-46981422 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1067643177 10:48070434-48070456 ACTCAGTAGCAGCTGTAGCCAGG + Intergenic
1069236744 10:66084920-66084942 ACTAATTAGGAACTGGTCCCAGG + Intronic
1070574564 10:77667777-77667799 TCTCATTGAGACATGGAGCCTGG - Intergenic
1075149639 10:119915422-119915444 AGTCAGTAGGGCCTGGAGCCTGG + Intronic
1077422302 11:2458508-2458530 CCTCACCAGGAGCTGGAGCCTGG - Intronic
1078169445 11:8917867-8917889 ACTCATTAGGTCATGAAGCCAGG + Intronic
1081456983 11:43233389-43233411 ACTCAGAAGGTCCAGGAGCCAGG + Intergenic
1082896233 11:58193185-58193207 ACTCACTAGGCTGTGGAGCCTGG - Intergenic
1084410477 11:69003601-69003623 ACTCATTCCCACCTGGAGCTCGG + Intergenic
1086853542 11:91839481-91839503 AGTCATTAGAACCTGGAGGAGGG - Intergenic
1088542464 11:110927442-110927464 CCTCATAAGGAACTGGAGCCAGG - Intergenic
1089616073 11:119695517-119695539 ACGCAGTAGGCCCTGGATCCAGG + Intronic
1090083040 11:123627046-123627068 CCTCAACAGGCCCTGGAGCCAGG + Intronic
1090946426 11:131433446-131433468 AGTCATGAGGCCCTGGAGGCAGG - Intronic
1096136025 12:49201996-49202018 ACACAATGAGACCTGGAGCCTGG - Intronic
1097011645 12:55957452-55957474 ACTCATACTTACCTGGAGCCTGG - Exonic
1097461847 12:59872045-59872067 CCTCATTAGATCCTGGTGCCAGG + Intergenic
1099956358 12:89354698-89354720 AGTCATTGGGACCTGGGGACAGG + Intergenic
1100579235 12:95922833-95922855 ACTCAAAAGGACCTGGGGCCAGG + Intronic
1102715951 12:114972748-114972770 CCTCATCAGGGCCTGGAACCAGG + Intergenic
1102939432 12:116926164-116926186 ACTCACTAGGAACTGGTGTCTGG - Intronic
1103742398 12:123099675-123099697 ACACAGTGGGACCTGGAGCCAGG - Intronic
1104973192 12:132540692-132540714 ACACATCAGCACCTGGAACCAGG + Intronic
1108155980 13:47584914-47584936 ACTCGTTGGGAACTGGAGCAAGG - Intergenic
1111323778 13:86664603-86664625 ACTTATTAGGAACTGGAGTATGG - Intergenic
1115271493 14:31558442-31558464 CCTCATTATGAACTGGAACCAGG + Intronic
1121571140 14:94947286-94947308 ACTCCACAGTACCTGGAGCCTGG - Intergenic
1122605903 14:102947574-102947596 ACGCACAAGGACCTGGAGCCAGG + Intronic
1124848727 15:33315395-33315417 ACTCACTAGCACCCAGAGCCTGG - Intronic
1128119858 15:65137689-65137711 ACTCATTAGGAACTGGTGCAAGG - Intergenic
1128978699 15:72170848-72170870 GCAGATTAGGAGCTGGAGCCTGG + Intronic
1130341292 15:83001225-83001247 GCTCATTATGCCCTGGAGGCAGG - Intronic
1131757023 15:95575667-95575689 ACTAACCAAGACCTGGAGCCAGG - Intergenic
1132114198 15:99123927-99123949 GCCCATTAGGGCCTGGCGCCTGG + Intronic
1133706954 16:8363932-8363954 ACTCATAAGGTCCTGTGGCCAGG + Intergenic
1133785828 16:8972444-8972466 ACTCATTAGGAACTCCAGCAGGG - Intergenic
1138727551 16:59156643-59156665 ACTCCTGTGGACCTGGATCCAGG - Intergenic
1139327554 16:66164059-66164081 ACTACTTAGGATCTGGAGTCTGG - Intergenic
1141054377 16:80803303-80803325 ACTCATTAGGACCTGGAGCCAGG + Intronic
1143263618 17:5619235-5619257 ACTAATAAGCACCTGGAGTCTGG - Intronic
1143792337 17:9307600-9307622 ACTCCTTAGGGCCTGGAAGCGGG + Intronic
1146547352 17:33750432-33750454 ACTCAGGAGGCCCTGGAGCCTGG + Intronic
1146622139 17:34406896-34406918 ACTCACTGGGACCTGGGACCTGG - Intergenic
1149413421 17:56432680-56432702 ACTGCCCAGGACCTGGAGCCTGG + Intronic
1149636756 17:58177124-58177146 AGCCATGAAGACCTGGAGCCTGG + Intergenic
1150504867 17:65688509-65688531 ACTCATTAGGCCCTAGAAACTGG + Intronic
1151878672 17:76881588-76881610 ACTCTCTAGGACCCGGGGCCCGG - Intronic
1168510490 19:56969697-56969719 ACTCATTTACAACTGGAGCCAGG + Intergenic
926795746 2:16617572-16617594 CCTCATTAAGGCCTGCAGCCAGG + Intronic
927136878 2:20103836-20103858 TCTCATTAGGATATGGAGCCTGG + Intergenic
927502559 2:23592259-23592281 ACTAATGGGGCCCTGGAGCCGGG - Intronic
928940365 2:36721348-36721370 ACACATGAGGACCTGGAGAGGGG - Intronic
932014342 2:68009238-68009260 ACTCTTTAAAACCTGAAGCCTGG + Intergenic
932975797 2:76598101-76598123 ACTCAGCAGTACCTGTAGCCAGG - Intergenic
933638125 2:84729318-84729340 ACTTAACAGGACCTGGAACCGGG + Intronic
934592611 2:95569578-95569600 ACTCCTTAGGATGTGGAGACTGG - Intergenic
934817194 2:97337942-97337964 ACGGATGAGGCCCTGGAGCCTGG + Intergenic
934820502 2:97370542-97370564 ACGGATGAGGCCCTGGAGCCTGG - Intergenic
938307833 2:130266871-130266893 AATCATTAGGACATGGAGTTGGG - Intergenic
938447504 2:131389970-131389992 AATCATTAGGACATGGAGTTGGG + Intergenic
939227427 2:139381814-139381836 ACTCAATAGCACCTGTAGCCAGG + Intergenic
940889323 2:159019585-159019607 ACTTGTTTGGACCTGGAGGCAGG + Intronic
942234238 2:173888953-173888975 ACTTATTGGGAACTGGAGCAAGG + Intergenic
943126735 2:183803755-183803777 ACTGAGTTGGAACTGGAGCCTGG + Intergenic
945537132 2:211031455-211031477 ACTCATTAGAACTTGAAGCAGGG - Intergenic
947663904 2:231890919-231890941 ACTCACCAGGGCCTGGACCCTGG + Intergenic
1170636578 20:18110691-18110713 TCTCATTAGGAGCAGGAGCAAGG - Intergenic
1174755642 20:53155670-53155692 ACTTTTTAGGACCTGGGCCCAGG + Intronic
1178799685 21:35780969-35780991 GCTCACTAGGACCTGGACCGGGG + Intronic
1179669470 21:42936233-42936255 ACGGATTCGGCCCTGGAGCCAGG + Intergenic
1179786261 21:43731920-43731942 ACTCTTTAGAACCTGGAGCTGGG + Intronic
1182866500 22:33608777-33608799 ACTCAGTAGGTACTGCAGCCGGG - Intronic
1183189369 22:36311968-36311990 GCTCTCTAGGACCAGGAGCCGGG - Intronic
949244682 3:1912956-1912978 ACTCATTAGTTCCTGGAACTGGG - Intergenic
950686942 3:14625533-14625555 ACTCAGTAGGTCCCGGGGCCGGG + Intergenic
961493301 3:127271758-127271780 CCTCCTGAGGACCTGGAGTCTGG - Intergenic
961948802 3:130723201-130723223 ACTCATTGGGTCCTCCAGCCTGG - Intronic
963347707 3:144115752-144115774 ACCCATTAGGTGCTGGAGCCAGG + Intergenic
963688789 3:148472266-148472288 ACTCCTTAGGTTCTGGAGCAAGG - Intergenic
965383878 3:168022832-168022854 CCGAATTAGGACCTGGGGCCAGG + Intronic
967553739 3:190830962-190830984 ATTCATAAGGAGCTGGAGCAGGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972396592 4:38663921-38663943 ACTCATTATTCCCCGGAGCCGGG - Intergenic
975134527 4:70861700-70861722 AATCATTACGATATGGAGCCTGG - Intergenic
985882637 5:2651332-2651354 ACACATGTGGGCCTGGAGCCAGG - Intergenic
986744462 5:10731472-10731494 AGATGTTAGGACCTGGAGCCTGG - Intronic
986974301 5:13377770-13377792 ACTCCTTGGGACCTTGAGCCGGG - Intergenic
990749548 5:58999844-58999866 ATTCATTAAGCCCTGGAGCTCGG - Intronic
996421962 5:123272081-123272103 ACTCATCAGAACTTGGAGACAGG - Intergenic
996651842 5:125887495-125887517 AGTCTTTGGGACCTGGAGCTTGG - Intergenic
997744077 5:136283471-136283493 ACTCATGCAGGCCTGGAGCCTGG - Intronic
1000938088 5:167327385-167327407 ACTCATTAAGAGCAAGAGCCAGG - Intronic
1002780006 6:358592-358614 GCCCATTAGGACCTGGACCCTGG + Intergenic
1007276373 6:40677158-40677180 ATTCTTTAGGACAGGGAGCCAGG + Intergenic
1007676628 6:43601167-43601189 ACTAATTAAGGACTGGAGCCAGG + Intronic
1007763127 6:44145843-44145865 ACTCACTAGTACCTGGTACCAGG - Intronic
1010879920 6:81154482-81154504 ACTCATTGGGAACTGGAGCAAGG - Intergenic
1013704988 6:112822232-112822254 ACAGATTAGGACTTGGAGCCAGG + Intergenic
1016649011 6:146442247-146442269 ACCCATTAGATCCTGGAGCAGGG + Intergenic
1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG + Intronic
1019506000 7:1391725-1391747 CCTCATGAGAGCCTGGAGCCAGG - Intergenic
1023113066 7:36833769-36833791 ACTCACCATGAACTGGAGCCTGG + Intergenic
1028239224 7:88399074-88399096 ACTCGTGGGGACCAGGAGCCGGG + Intergenic
1031464021 7:122085804-122085826 ACTCATTAGGAGTTGGGGACAGG - Intronic
1032457291 7:132083079-132083101 ACTGATTAGGACCAAGAACCAGG - Intergenic
1034780923 7:153881787-153881809 AGCCATTAGGACCTGGAGCCAGG - Intergenic
1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG + Intronic
1037953785 8:23037293-23037315 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1037996197 8:23354074-23354096 AGTCACTAAGCCCTGGAGCCTGG - Intronic
1038188733 8:25299329-25299351 ACTCATTAGGGCTTGGAGATGGG + Intronic
1040286162 8:46101483-46101505 ACTCAGGAGGACCTTGAGACAGG - Intergenic
1040314536 8:46254079-46254101 ACTCAGAAGGACGTTGAGCCAGG + Intergenic
1040331379 8:46387454-46387476 ACTCATTGGGACCTTGAGGCAGG + Intergenic
1040331796 8:46389401-46389423 ACTCACAAGGACCTTGAGGCAGG + Intergenic
1040333138 8:46402461-46402483 ACTCAGTAGGACATTGAGGCAGG + Intergenic
1044152126 8:88794014-88794036 AATCATTGGGACCTGGGGCTAGG + Intergenic
1051725683 9:20086400-20086422 ACACATTAGGGCTTGGAGGCTGG - Intergenic
1057863884 9:98663999-98664021 ACTCATTATGATCTGGACCTGGG - Intronic
1058456603 9:105143507-105143529 ATCCTGTAGGACCTGGAGCCAGG - Intergenic
1059953415 9:119491287-119491309 AATCATTAGGACCTGCAGCATGG - Intergenic
1062286585 9:135775750-135775772 GCTCATTAGGACAGGGACCCCGG + Intronic
1187944461 X:24412669-24412691 ACACATTAGGACCAGGAACAAGG - Intergenic
1189739682 X:44105122-44105144 AGGCATTAAGAGCTGGAGCCAGG + Intergenic
1192065455 X:67880170-67880192 ACAGAATAGGACCTGGAGACAGG + Intergenic
1192130259 X:68543146-68543168 ACTCTTTGGGAGCTGGAGGCAGG - Intergenic
1193794774 X:85860184-85860206 AATCATTAGAACCTGGATCCTGG - Intergenic
1195571384 X:106401831-106401853 ACTCATCAGGACCTGGCTCCTGG - Intergenic
1199055239 X:143286284-143286306 CCCCACTAGGACCTGGGGCCAGG - Intergenic
1199077965 X:143545726-143545748 ACTTATTGGGAACTGGAGCAGGG - Intergenic
1200123109 X:153800565-153800587 GCTCATATGGGCCTGGAGCCTGG - Intergenic