ID: 1141055255

View in Genome Browser
Species Human (GRCh38)
Location 16:80807793-80807815
Sequence CGATTCCCATCATGTAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141055255_1141055259 4 Left 1141055255 16:80807793-80807815 CCAGAATTACATGATGGGAATCG No data
Right 1141055259 16:80807820-80807842 TGAGCAGAAGCCTAAAGGAATGG No data
1141055255_1141055260 7 Left 1141055255 16:80807793-80807815 CCAGAATTACATGATGGGAATCG No data
Right 1141055260 16:80807823-80807845 GCAGAAGCCTAAAGGAATGGTGG No data
1141055255_1141055258 -1 Left 1141055255 16:80807793-80807815 CCAGAATTACATGATGGGAATCG No data
Right 1141055258 16:80807815-80807837 GGGTCTGAGCAGAAGCCTAAAGG No data
1141055255_1141055264 28 Left 1141055255 16:80807793-80807815 CCAGAATTACATGATGGGAATCG No data
Right 1141055264 16:80807844-80807866 GGAAGGAATACTGAAACGGTAGG No data
1141055255_1141055263 24 Left 1141055255 16:80807793-80807815 CCAGAATTACATGATGGGAATCG No data
Right 1141055263 16:80807840-80807862 TGGTGGAAGGAATACTGAAACGG No data
1141055255_1141055261 11 Left 1141055255 16:80807793-80807815 CCAGAATTACATGATGGGAATCG No data
Right 1141055261 16:80807827-80807849 AAGCCTAAAGGAATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141055255 Original CRISPR CGATTCCCATCATGTAATTC TGG (reversed) Intergenic
No off target data available for this crispr