ID: 1141055261

View in Genome Browser
Species Human (GRCh38)
Location 16:80807827-80807849
Sequence AAGCCTAAAGGAATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141055255_1141055261 11 Left 1141055255 16:80807793-80807815 CCAGAATTACATGATGGGAATCG No data
Right 1141055261 16:80807827-80807849 AAGCCTAAAGGAATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141055261 Original CRISPR AAGCCTAAAGGAATGGTGGA AGG Intergenic
No off target data available for this crispr