ID: 1141056164

View in Genome Browser
Species Human (GRCh38)
Location 16:80816610-80816632
Sequence CTGAAGCTCCACCACGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141056156_1141056164 21 Left 1141056156 16:80816566-80816588 CCAATCTGGGGATGACAAGTGAG No data
Right 1141056164 16:80816610-80816632 CTGAAGCTCCACCACGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141056164 Original CRISPR CTGAAGCTCCACCACGGAAA AGG Intergenic
No off target data available for this crispr