ID: 1141057629

View in Genome Browser
Species Human (GRCh38)
Location 16:80833315-80833337
Sequence ACCTCTCCTAGTACATGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141057629_1141057634 15 Left 1141057629 16:80833315-80833337 CCATCTCATGTACTAGGAGAGGT No data
Right 1141057634 16:80833353-80833375 GTGCCTCAGAGAGTGAGAATGGG No data
1141057629_1141057637 27 Left 1141057629 16:80833315-80833337 CCATCTCATGTACTAGGAGAGGT No data
Right 1141057637 16:80833365-80833387 GTGAGAATGGGAAAGAGGAGTGG No data
1141057629_1141057633 14 Left 1141057629 16:80833315-80833337 CCATCTCATGTACTAGGAGAGGT No data
Right 1141057633 16:80833352-80833374 AGTGCCTCAGAGAGTGAGAATGG No data
1141057629_1141057636 22 Left 1141057629 16:80833315-80833337 CCATCTCATGTACTAGGAGAGGT No data
Right 1141057636 16:80833360-80833382 AGAGAGTGAGAATGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141057629 Original CRISPR ACCTCTCCTAGTACATGAGA TGG (reversed) Intergenic
No off target data available for this crispr