ID: 1141057746

View in Genome Browser
Species Human (GRCh38)
Location 16:80834315-80834337
Sequence TTGTAACAATGGTGGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141057746_1141057754 4 Left 1141057746 16:80834315-80834337 CCCATCTCCCACCATTGTTACAA No data
Right 1141057754 16:80834342-80834364 CAACTCCATGCCTAGAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141057746 Original CRISPR TTGTAACAATGGTGGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr