ID: 1141061482

View in Genome Browser
Species Human (GRCh38)
Location 16:80876273-80876295
Sequence GCTCCCACTCCTGTCTCAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141061482_1141061485 5 Left 1141061482 16:80876273-80876295 CCGTTTGAGACAGGAGTGGGAGC No data
Right 1141061485 16:80876301-80876323 GTTCAACGGTTGCATCCAGATGG No data
1141061482_1141061486 11 Left 1141061482 16:80876273-80876295 CCGTTTGAGACAGGAGTGGGAGC No data
Right 1141061486 16:80876307-80876329 CGGTTGCATCCAGATGGATTTGG No data
1141061482_1141061483 -9 Left 1141061482 16:80876273-80876295 CCGTTTGAGACAGGAGTGGGAGC No data
Right 1141061483 16:80876287-80876309 AGTGGGAGCATCCAGTTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141061482 Original CRISPR GCTCCCACTCCTGTCTCAAA CGG (reversed) Intergenic