ID: 1141065856

View in Genome Browser
Species Human (GRCh38)
Location 16:80913068-80913090
Sequence TTGGAGAAGCAGGAAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141065856_1141065860 3 Left 1141065856 16:80913068-80913090 CCTGGCTCTTCCTGCTTCTCCAA No data
Right 1141065860 16:80913094-80913116 CTGAACTGTCACCCAGAACCTGG No data
1141065856_1141065863 19 Left 1141065856 16:80913068-80913090 CCTGGCTCTTCCTGCTTCTCCAA No data
Right 1141065863 16:80913110-80913132 AACCTGGATGTTTGACAAACTGG No data
1141065856_1141065865 24 Left 1141065856 16:80913068-80913090 CCTGGCTCTTCCTGCTTCTCCAA No data
Right 1141065865 16:80913115-80913137 GGATGTTTGACAAACTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141065856 Original CRISPR TTGGAGAAGCAGGAAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr