ID: 1141065860

View in Genome Browser
Species Human (GRCh38)
Location 16:80913094-80913116
Sequence CTGAACTGTCACCCAGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141065857_1141065860 -7 Left 1141065857 16:80913078-80913100 CCTGCTTCTCCAAGACCTGAACT No data
Right 1141065860 16:80913094-80913116 CTGAACTGTCACCCAGAACCTGG No data
1141065854_1141065860 28 Left 1141065854 16:80913043-80913065 CCTTTCACAGGTATTGAAGGCTC No data
Right 1141065860 16:80913094-80913116 CTGAACTGTCACCCAGAACCTGG No data
1141065856_1141065860 3 Left 1141065856 16:80913068-80913090 CCTGGCTCTTCCTGCTTCTCCAA No data
Right 1141065860 16:80913094-80913116 CTGAACTGTCACCCAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141065860 Original CRISPR CTGAACTGTCACCCAGAACC TGG Intergenic
No off target data available for this crispr