ID: 1141065863

View in Genome Browser
Species Human (GRCh38)
Location 16:80913110-80913132
Sequence AACCTGGATGTTTGACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141065857_1141065863 9 Left 1141065857 16:80913078-80913100 CCTGCTTCTCCAAGACCTGAACT No data
Right 1141065863 16:80913110-80913132 AACCTGGATGTTTGACAAACTGG No data
1141065856_1141065863 19 Left 1141065856 16:80913068-80913090 CCTGGCTCTTCCTGCTTCTCCAA No data
Right 1141065863 16:80913110-80913132 AACCTGGATGTTTGACAAACTGG No data
1141065858_1141065863 0 Left 1141065858 16:80913087-80913109 CCAAGACCTGAACTGTCACCCAG No data
Right 1141065863 16:80913110-80913132 AACCTGGATGTTTGACAAACTGG No data
1141065859_1141065863 -6 Left 1141065859 16:80913093-80913115 CCTGAACTGTCACCCAGAACCTG No data
Right 1141065863 16:80913110-80913132 AACCTGGATGTTTGACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141065863 Original CRISPR AACCTGGATGTTTGACAAAC TGG Intergenic
No off target data available for this crispr