ID: 1141065865

View in Genome Browser
Species Human (GRCh38)
Location 16:80913115-80913137
Sequence GGATGTTTGACAAACTGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141065859_1141065865 -1 Left 1141065859 16:80913093-80913115 CCTGAACTGTCACCCAGAACCTG No data
Right 1141065865 16:80913115-80913137 GGATGTTTGACAAACTGGATAGG No data
1141065858_1141065865 5 Left 1141065858 16:80913087-80913109 CCAAGACCTGAACTGTCACCCAG No data
Right 1141065865 16:80913115-80913137 GGATGTTTGACAAACTGGATAGG No data
1141065856_1141065865 24 Left 1141065856 16:80913068-80913090 CCTGGCTCTTCCTGCTTCTCCAA No data
Right 1141065865 16:80913115-80913137 GGATGTTTGACAAACTGGATAGG No data
1141065857_1141065865 14 Left 1141065857 16:80913078-80913100 CCTGCTTCTCCAAGACCTGAACT No data
Right 1141065865 16:80913115-80913137 GGATGTTTGACAAACTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141065865 Original CRISPR GGATGTTTGACAAACTGGAT AGG Intergenic
No off target data available for this crispr