ID: 1141066175

View in Genome Browser
Species Human (GRCh38)
Location 16:80915864-80915886
Sequence GCAGGTGACCACAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141066168_1141066175 18 Left 1141066168 16:80915823-80915845 CCCTTCTGTTGTTAGTTGGGTTC No data
Right 1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG No data
1141066165_1141066175 26 Left 1141066165 16:80915815-80915837 CCAAATTACCCTTCTGTTGTTAG No data
Right 1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG No data
1141066172_1141066175 -7 Left 1141066172 16:80915848-80915870 CCAACAGGAAGCACATGCAGGTG No data
Right 1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG No data
1141066169_1141066175 17 Left 1141066169 16:80915824-80915846 CCTTCTGTTGTTAGTTGGGTTCA No data
Right 1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141066175 Original CRISPR GCAGGTGACCACAGGGTAGA AGG Intergenic
No off target data available for this crispr