ID: 1141068445

View in Genome Browser
Species Human (GRCh38)
Location 16:80932470-80932492
Sequence CCCGGAGCCCGGCTCTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141068445_1141068450 -6 Left 1141068445 16:80932470-80932492 CCTGCGCAGAGCCGGGCTCCGGG No data
Right 1141068450 16:80932487-80932509 TCCGGGGCCCTGGCCGCTCTCGG No data
1141068445_1141068464 27 Left 1141068445 16:80932470-80932492 CCTGCGCAGAGCCGGGCTCCGGG No data
Right 1141068464 16:80932520-80932542 CGGGTTCCCACCAGGCCAGAGGG No data
1141068445_1141068459 19 Left 1141068445 16:80932470-80932492 CCTGCGCAGAGCCGGGCTCCGGG No data
Right 1141068459 16:80932512-80932534 AGGCCCCGCGGGTTCCCACCAGG No data
1141068445_1141068458 8 Left 1141068445 16:80932470-80932492 CCTGCGCAGAGCCGGGCTCCGGG No data
Right 1141068458 16:80932501-80932523 CGCTCTCGGGAAGGCCCCGCGGG No data
1141068445_1141068452 -5 Left 1141068445 16:80932470-80932492 CCTGCGCAGAGCCGGGCTCCGGG No data
Right 1141068452 16:80932488-80932510 CCGGGGCCCTGGCCGCTCTCGGG No data
1141068445_1141068457 7 Left 1141068445 16:80932470-80932492 CCTGCGCAGAGCCGGGCTCCGGG No data
Right 1141068457 16:80932500-80932522 CCGCTCTCGGGAAGGCCCCGCGG No data
1141068445_1141068463 26 Left 1141068445 16:80932470-80932492 CCTGCGCAGAGCCGGGCTCCGGG No data
Right 1141068463 16:80932519-80932541 GCGGGTTCCCACCAGGCCAGAGG No data
1141068445_1141068453 -1 Left 1141068445 16:80932470-80932492 CCTGCGCAGAGCCGGGCTCCGGG No data
Right 1141068453 16:80932492-80932514 GGCCCTGGCCGCTCTCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141068445 Original CRISPR CCCGGAGCCCGGCTCTGCGC AGG (reversed) Intergenic
No off target data available for this crispr