ID: 1141069973 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:80945316-80945338 |
| Sequence | AGCACTCCCCCACCAACGTG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141069973_1141069975 | -4 | Left | 1141069973 | 16:80945316-80945338 | CCGCACGTTGGTGGGGGAGTGCT | No data | ||
| Right | 1141069975 | 16:80945335-80945357 | TGCTACTGGCATCTGATGAGTGG | No data | ||||
| 1141069973_1141069976 | 4 | Left | 1141069973 | 16:80945316-80945338 | CCGCACGTTGGTGGGGGAGTGCT | No data | ||
| Right | 1141069976 | 16:80945343-80945365 | GCATCTGATGAGTGGAGCCACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141069973 | Original CRISPR | AGCACTCCCCCACCAACGTG CGG (reversed) | Intergenic | ||