ID: 1141069973

View in Genome Browser
Species Human (GRCh38)
Location 16:80945316-80945338
Sequence AGCACTCCCCCACCAACGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141069973_1141069975 -4 Left 1141069973 16:80945316-80945338 CCGCACGTTGGTGGGGGAGTGCT No data
Right 1141069975 16:80945335-80945357 TGCTACTGGCATCTGATGAGTGG No data
1141069973_1141069976 4 Left 1141069973 16:80945316-80945338 CCGCACGTTGGTGGGGGAGTGCT No data
Right 1141069976 16:80945343-80945365 GCATCTGATGAGTGGAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141069973 Original CRISPR AGCACTCCCCCACCAACGTG CGG (reversed) Intergenic