ID: 1141071724

View in Genome Browser
Species Human (GRCh38)
Location 16:80962560-80962582
Sequence CTGTATATCTTAAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141071724_1141071731 11 Left 1141071724 16:80962560-80962582 CCATCTTCCTTTAAGATATACAG No data
Right 1141071731 16:80962594-80962616 GTCTTCTTGCAGGTATAGCTGGG No data
1141071724_1141071732 12 Left 1141071724 16:80962560-80962582 CCATCTTCCTTTAAGATATACAG No data
Right 1141071732 16:80962595-80962617 TCTTCTTGCAGGTATAGCTGGGG No data
1141071724_1141071730 10 Left 1141071724 16:80962560-80962582 CCATCTTCCTTTAAGATATACAG No data
Right 1141071730 16:80962593-80962615 AGTCTTCTTGCAGGTATAGCTGG No data
1141071724_1141071726 1 Left 1141071724 16:80962560-80962582 CCATCTTCCTTTAAGATATACAG No data
Right 1141071726 16:80962584-80962606 CATGCCCCAAGTCTTCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141071724 Original CRISPR CTGTATATCTTAAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr