ID: 1141072988

View in Genome Browser
Species Human (GRCh38)
Location 16:80975046-80975068
Sequence GCCCCTGCTGTGACTGCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 380}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141072984_1141072988 30 Left 1141072984 16:80974993-80975015 CCACTAGAAGGAGCTCACAGCTG 0: 1
1: 0
2: 1
3: 21
4: 181
Right 1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 380
1141072987_1141072988 -9 Left 1141072987 16:80975032-80975054 CCTGACAAGATCAAGCCCCTGCT 0: 1
1: 0
2: 1
3: 13
4: 227
Right 1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 380
1141072985_1141072988 -1 Left 1141072985 16:80975024-80975046 CCCTGACACCTGACAAGATCAAG 0: 1
1: 0
2: 1
3: 14
4: 164
Right 1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 380
1141072986_1141072988 -2 Left 1141072986 16:80975025-80975047 CCTGACACCTGACAAGATCAAGC 0: 1
1: 1
2: 0
3: 6
4: 139
Right 1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141072988 Original CRISPR GCCCCTGCTGTGACTGCAGC TGG Exonic
900481962 1:2903740-2903762 GTCTCTGCTATGACTGTAGCAGG + Intergenic
900998217 1:6134256-6134278 CCTCCTGCTGTGTCTGCAGGAGG - Exonic
901036643 1:6339883-6339905 GCGCCCGCTGGGACTACAGCGGG + Intronic
901312035 1:8276733-8276755 GCCGGTGGTGTGGCTGCAGCCGG - Intergenic
902180850 1:14687256-14687278 GCACCTGCTGTGACTGGCCCTGG + Intronic
902364802 1:15965576-15965598 GCCTCTCCAGGGACTGCAGCTGG - Intronic
903141879 1:21344198-21344220 GCCCCTGCTGTGCCCAGAGCTGG - Intronic
903176933 1:21587044-21587066 TCCTGTGCTGTGACTGCAGGCGG + Intergenic
903345906 1:22684258-22684280 GGCCCTGCTGCGGCTCCAGCTGG - Intergenic
903752678 1:25636813-25636835 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
905172904 1:36119529-36119551 GCCCCTGCTGCCGCTGCAGGAGG + Intronic
905246156 1:36615461-36615483 GGTCCTGATGTGACTGCAGAAGG + Intergenic
905363049 1:37433525-37433547 CCCCCTGCTGTGACTATAGTGGG + Intergenic
905631449 1:39521312-39521334 ACCGCTGCTGTGTCTGCTGCAGG + Intronic
905666305 1:39764859-39764881 ACCGCTGCTGTGTCTGCTGCAGG - Intronic
905941343 1:41866005-41866027 CCCGCTGCTGTGATGGCAGCTGG + Intronic
907492500 1:54817114-54817136 GCTCATGCAGTGAGTGCAGCTGG + Exonic
907497417 1:54854066-54854088 GCCCATGAAGTGCCTGCAGCAGG - Exonic
908252116 1:62273660-62273682 GCCCCAGCTGTCACTGCCACAGG - Exonic
910041089 1:82852175-82852197 GCCCCAGGTGTGACTACAGTGGG - Intergenic
911024950 1:93426656-93426678 GGCCATGCTGTGACAGCACCTGG - Intergenic
915244610 1:154547524-154547546 GCCCTTGGGGTGTCTGCAGCAGG + Exonic
915679069 1:157562557-157562579 GCCCCTGCTGCTGCTACAGCTGG - Intergenic
916653356 1:166850656-166850678 GCCGCTGCTGTGACAGCGGGCGG - Exonic
920431506 1:205921898-205921920 GACCTTGCTGTGACTGAAGCAGG + Intronic
921051849 1:211516568-211516590 GCTCCTGATGTGACTGCACTGGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922558614 1:226550813-226550835 GCCGATGCTGTCAATGCAGCAGG - Intronic
922831773 1:228557837-228557859 ACCCCGGCTGCGGCTGCAGCGGG + Intergenic
923678928 1:236103312-236103334 GGCTCGGCGGTGACTGCAGCTGG + Intergenic
923861246 1:237894171-237894193 TGCCCCGCTGTGACTGGAGCAGG + Intergenic
923898505 1:238299969-238299991 GCCTCTGCTTTGACTCCAACAGG + Intergenic
924516077 1:244767639-244767661 ACCACTACTGTGACTGCACCAGG + Intergenic
1062767023 10:73928-73950 GCCCGCGCTGCGAGTGCAGCGGG - Intergenic
1064053927 10:12081590-12081612 GTCCCTGCAGTGTCTGCACCAGG - Exonic
1064523033 10:16223524-16223546 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1065110644 10:22436923-22436945 ACCCCTGCGGTGACTGCTGTCGG - Intronic
1067238307 10:44469849-44469871 GCCCCTGCTGACCCTGCACCTGG - Intergenic
1067901608 10:50247510-50247532 GACCCTGCTGTGCCTACTGCTGG + Intronic
1068217377 10:53999924-53999946 CCCACTGCTGGGACTGCAGTGGG - Intronic
1068716931 10:60199024-60199046 GCCCCTGCTGACCCTTCAGCTGG - Intronic
1068731951 10:60367947-60367969 GAGCCTGCTGTGAATGCAGATGG + Intronic
1068962050 10:62876961-62876983 GCCCCTCCTGAGACTGCACTGGG + Intronic
1069570085 10:69489526-69489548 TCCTCTGCTGTGGCTGCAGCTGG + Intronic
1069628372 10:69881956-69881978 GGCCCGTCTATGACTGCAGCAGG - Intronic
1070640238 10:78163173-78163195 GCCTCTTCTATCACTGCAGCAGG - Intergenic
1072426386 10:95334318-95334340 TCCCCTCCTGTGGCTGGAGCAGG - Intronic
1072853519 10:98922707-98922729 GCCCCTACTGTCTCTGCTGCTGG - Intronic
1073042245 10:100615612-100615634 GCCCCAGCGGGGCCTGCAGCGGG - Intergenic
1073118687 10:101108196-101108218 GCCCCTGCTGTGACCCCTCCTGG - Intronic
1073283268 10:102370215-102370237 GCTCCTGTAGTGACTCCAGCTGG - Exonic
1073432283 10:103494258-103494280 GGCCCTGCTGGGGCTGCAGCCGG - Exonic
1074307704 10:112294160-112294182 GTCACTGCTGTAACTCCAGCAGG - Intronic
1075125903 10:119698651-119698673 GCCCCTGCTGTGAGTGGGGCAGG - Intergenic
1075241561 10:120784033-120784055 GCACCTCCTGTGACTGCTTCAGG + Intergenic
1075495428 10:122915318-122915340 GCCCCTGCGATGCCTGCACCAGG - Intergenic
1075715670 10:124553838-124553860 GCCCCTCCTCTGTCTGCAGAAGG + Intronic
1075733621 10:124651111-124651133 GCCCCTGTGCTGAGTGCAGCTGG - Intronic
1076550678 10:131276033-131276055 GCCCATACTGTGTATGCAGCAGG + Intronic
1076625529 10:131819387-131819409 GCCCCTGCTGTGACACCACACGG - Intergenic
1076649693 10:131979382-131979404 CCCACTGCTGTGTCTGCAACTGG - Intronic
1076744895 10:132507918-132507940 GACCCTGCTGTGGCTCCAGACGG - Intergenic
1076806113 10:132859663-132859685 GGCCCTGCTGTGGCTGCTCCGGG - Intronic
1076854024 10:133106476-133106498 GCCCCTGCTGTGCCAGGATCTGG + Intronic
1077012651 11:385751-385773 GACCCGGCTGTGCCTTCAGCTGG - Intergenic
1077056026 11:593622-593644 GCCCCTGCAGTGTCTGCAAAAGG - Intronic
1077094058 11:791929-791951 GTCCCTGCTGGGGCTGCTGCAGG - Exonic
1077269925 11:1671126-1671148 GACTCTGCTGGGTCTGCAGCTGG - Intergenic
1077317141 11:1924687-1924709 GCCCCGGCTCTGAGTGCACCCGG - Intronic
1078436152 11:11327609-11327631 GCCACTGCTGGGTCTGCAGGAGG - Intronic
1078514113 11:12008543-12008565 CACCCTGCTGTGCCTGCTGCTGG - Exonic
1078616551 11:12871215-12871237 GACACTGCTGTCGCTGCAGCTGG - Intronic
1079136015 11:17776404-17776426 GCCCCTCCGGTGCCCGCAGCTGG + Intronic
1081814128 11:45929172-45929194 GGCCCTCCTGTGACCCCAGCTGG - Intergenic
1083475112 11:62910309-62910331 GCCGCTGCTGTCGCTGCTGCCGG - Exonic
1083639137 11:64135956-64135978 TCCCCTGCGCTGGCTGCAGCAGG - Intronic
1083768579 11:64854008-64854030 GCCTTTGCTGTGGCTGGAGCTGG - Exonic
1085356388 11:75842018-75842040 GCCCCAGCTGAGATTCCAGCAGG - Intronic
1087681350 11:101221326-101221348 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1088694844 11:112357791-112357813 GCCCCAGCTGTGCATGTAGCAGG + Intergenic
1089535036 11:119155840-119155862 GCCCATGCTGTGTCTTCTGCTGG + Intronic
1089877687 11:121741483-121741505 GGCCCTGATTTAACTGCAGCAGG - Intergenic
1090339978 11:126009230-126009252 GCCCTTGCTCTGAATGAAGCTGG - Intronic
1090592022 11:128282219-128282241 GCCCCTTTTGTGACTTCAGCTGG - Intergenic
1091357546 11:134949200-134949222 ACCTCTCCAGTGACTGCAGCGGG - Intergenic
1091433671 12:457350-457372 TCCCCTGCTGTGACATCACCAGG + Intergenic
1092365420 12:7873015-7873037 ACCCCTGCTCTGACCGCAGGTGG - Intronic
1092383629 12:8018896-8018918 ACCCCTGCTCTGACCGCAGGTGG - Intergenic
1093200057 12:16175819-16175841 GCCCCTGCTGTCTCTTAAGCAGG - Intergenic
1095307082 12:40651303-40651325 GCACCAGCTGAGCCTGCAGCTGG + Intergenic
1095953094 12:47791946-47791968 GCTCCTGCGGTGACAACAGCAGG - Exonic
1096870881 12:54591330-54591352 GCCCAGGCTGTGACTGCAGCAGG - Intergenic
1096979682 12:55721307-55721329 GCGCCTTCTGGCACTGCAGCTGG + Exonic
1097767513 12:63542868-63542890 ATCCCCGCTGTGGCTGCAGCTGG + Intergenic
1097783879 12:63737916-63737938 ATCCCCGCTGTGGCTGCAGCTGG + Intergenic
1099100859 12:78439091-78439113 GCCACTGCTGGGACTGCACTGGG + Intergenic
1100087571 12:90930305-90930327 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1100970521 12:100065073-100065095 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1102733566 12:115136922-115136944 GCCCCCTCTGGGACTGCAGAGGG - Intergenic
1102962852 12:117104704-117104726 GCCCCTGCAGTGACTGGTACCGG - Intergenic
1103209984 12:119158597-119158619 GCCAGTGCTGTCACTGCAGAAGG + Exonic
1103405798 12:120674432-120674454 GATCCTGCTGTGCCTGTAGCAGG + Intergenic
1103880234 12:124160340-124160362 GCCCCGGCTGCAGCTGCAGCTGG + Intronic
1104845621 12:131845328-131845350 GCACCTGGTGTCCCTGCAGCCGG + Exonic
1104989935 12:132619364-132619386 GCCCCTGCCGTGCCTGCGGGCGG + Intronic
1105261246 13:18780930-18780952 GCCCTTGCTGTGACTGGTCCTGG - Intergenic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1105817596 13:24051278-24051300 GGACATGCTGTGCCTGCAGCCGG + Intronic
1105897809 13:24732203-24732225 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1106515039 13:30445812-30445834 GCCCCTGTGGTGGCAGCAGCTGG + Intergenic
1107851270 13:44575941-44575963 GCCTCTGCTCTCAATGCAGCAGG - Exonic
1108960574 13:56222607-56222629 TCCCCTGCAGTGGCTCCAGCTGG + Intergenic
1110890155 13:80688885-80688907 GCCACAGCTGAGACTGGAGCTGG + Intergenic
1110953621 13:81524628-81524650 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
1110967361 13:81716329-81716351 CCCACTGCTGTGATTGCAACAGG + Intergenic
1112538665 13:100285027-100285049 GCCCCAGCTTTGCCTACAGCAGG + Intronic
1113149304 13:107243799-107243821 GCCTCTGCTGTGGCTACAGGAGG + Intronic
1113450098 13:110402953-110402975 GCCCCAGCTGTGGCTCCAGTGGG - Intronic
1113572571 13:111369356-111369378 GCCCCTGCTGTGATTTGAACAGG + Intergenic
1116334504 14:43639859-43639881 TCCACTGCTGCTACTGCAGCTGG + Intergenic
1117518922 14:56530926-56530948 GCTCTTGCTGTGCCTGCAGCAGG + Intronic
1118216403 14:63812704-63812726 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1118765079 14:68904212-68904234 GCCCCAGCTCTGACTGGGGCTGG - Intronic
1119480611 14:74955589-74955611 CTCCCTTCTGAGACTGCAGCCGG + Exonic
1121109245 14:91301267-91301289 TCCCTTGCTGTGTCTGCAGCAGG - Intronic
1121287628 14:92748613-92748635 GGCACTGCTGTGATTGCTGCGGG + Exonic
1121985656 14:98502851-98502873 GCCCCTGCTGTCTCTCCAGTTGG - Intergenic
1122104476 14:99441734-99441756 GCCCCTGCTGTGGCCTCATCAGG - Intronic
1122761701 14:104033527-104033549 GCCCTTGCTGGGGCTGCAGCAGG + Intronic
1122945437 14:105006456-105006478 GCCCCTTCTCTGACCCCAGCGGG + Intronic
1123563464 15:21516457-21516479 GCCCCTGCCATGGCCGCAGCTGG - Intergenic
1123599716 15:21953743-21953765 GCCCCTGCCATGGCCGCAGCTGG - Intergenic
1123858458 15:24437493-24437515 CCCACTACCGTGACTGCAGCTGG - Intergenic
1124363387 15:29054693-29054715 GTGCCTGCTGGGGCTGCAGCTGG - Exonic
1125506728 15:40271663-40271685 GCCCTGCCTGTGCCTGCAGCAGG - Intronic
1125731923 15:41897335-41897357 GCCGCGGCTGTGACTCCCGCGGG + Exonic
1126805132 15:52340360-52340382 TCCTCTTCTGTGACTGCAGCTGG + Exonic
1127528564 15:59818590-59818612 ACCCCAGCTGTGACTGTAACAGG - Intergenic
1128264141 15:66253167-66253189 GCCGGTGCAGTGAGTGCAGCCGG + Intronic
1128700365 15:69799522-69799544 GCCACAGCTGTGCCTGGAGCTGG - Intergenic
1128712598 15:69883563-69883585 GCCCCTGCTGTCCTTGCAGAAGG - Intergenic
1129744741 15:78010198-78010220 TCCCCTGCTGTGCATGCAGTGGG - Intronic
1130348039 15:83067025-83067047 GCCCCTGCTCCCCCTGCAGCGGG - Exonic
1130717752 15:86352591-86352613 GCCCCTCGGGAGACTGCAGCAGG - Intronic
1130892478 15:88144941-88144963 GCCCCTTCTGTCCCTGCAGAGGG + Intronic
1131260927 15:90887323-90887345 GGTCCTGCAGTGACCGCAGCAGG - Exonic
1132256999 15:100384529-100384551 GCCCCAGCTGTGACAGCAAGGGG + Intergenic
1132413080 15:101600212-101600234 GCCTCTGCTGACACTGCAGGTGG + Intergenic
1132603611 16:784568-784590 ACCCCAGCGGTGACAGCAGCAGG - Intergenic
1132747131 16:1441502-1441524 GCCCCTGCTGAGGCCACAGCAGG + Intronic
1132781079 16:1626017-1626039 GCCCCTGCTGCCCCTGCAGGGGG + Exonic
1133216758 16:4297237-4297259 GTCCCAGCTGGGGCTGCAGCTGG - Intergenic
1134055913 16:11169800-11169822 GGCCCTGCCGTGGCTACAGCAGG - Intronic
1135627640 16:24010130-24010152 GCCCCTGCTGGCTCTGAAGCTGG - Intronic
1137619601 16:49867808-49867830 GGCCCTGCTGTGACAGCCACTGG + Intergenic
1138011402 16:53384200-53384222 TCTTCTGCTGTGACTTCAGCTGG - Intergenic
1138594227 16:58021152-58021174 GCCCCTGCTGGTACAGGAGCAGG - Exonic
1138608663 16:58105741-58105763 GCCCCTCCTCTGTCTGCAGGGGG + Intergenic
1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG + Exonic
1141301995 16:82825584-82825606 GCCACTGCAGTCACTCCAGCCGG - Intronic
1142031700 16:87841699-87841721 GCCCCTGCCCCGGCTGCAGCTGG - Intronic
1142164699 16:88579910-88579932 GCTCCTGCTGTGGGGGCAGCAGG + Intronic
1142270303 16:89085550-89085572 GCCCCTCCTGTGCCTGGACCGGG + Intergenic
1142344417 16:89544949-89544971 GCCACAGCAGTGAGTGCAGCCGG - Intronic
1144589510 17:16512371-16512393 ATCCCTGCTGTGCCTGGAGCAGG + Intergenic
1144831955 17:18136768-18136790 TCCCTTTCTGTGCCTGCAGCAGG + Intronic
1145208761 17:20997967-20997989 GTGCCTGCTGTGGCTGCGGCAGG - Intergenic
1145234666 17:21200141-21200163 GTCACTGCTGGGGCTGCAGCCGG - Intronic
1145306603 17:21678948-21678970 GCCCCCGCCGCGGCTGCAGCAGG - Intergenic
1145370501 17:22303003-22303025 GCCATTGCTGTGGCTGCAGCAGG + Intergenic
1145736280 17:27234166-27234188 TGCCCTGCTGTGACTCCTGCAGG + Intergenic
1147243717 17:39107374-39107396 GACCCAGCTGTCTCTGCAGCTGG + Intronic
1147561905 17:41514467-41514489 GCCCCAGGTGAGATTGCAGCTGG - Intronic
1147740866 17:42670286-42670308 GCGCCTGCAGAGCCTGCAGCGGG - Exonic
1148021785 17:44558189-44558211 GCCGCCGCCGGGACTGCAGCCGG + Exonic
1148207955 17:45791354-45791376 GCCCGTGCTCTGAGTGCAGTTGG - Intronic
1148243795 17:46017148-46017170 ACCCCAGCTGTGAGAGCAGCTGG + Intronic
1148699827 17:49580678-49580700 GACCCTGCTGGGTCTGCAGATGG - Intronic
1149461898 17:56835046-56835068 GCGCCTTCTGCGACTGCTGCGGG + Exonic
1150296185 17:64008855-64008877 GGCCCTGCTGTGTATGCAGGTGG - Intronic
1150983431 17:70169271-70169293 GGCCCAGCTGGGACAGCAGCAGG - Intronic
1151600858 17:75105232-75105254 GGTCCTGCTGAGACTGCAGGGGG - Intronic
1151847781 17:76669725-76669747 GCCACTGCAGAGACTGAAGCAGG - Intergenic
1151936202 17:77263210-77263232 GCCCCTCCCCTGGCTGCAGCAGG - Intergenic
1152257362 17:79248021-79248043 GCTCCTGCTGTGACTGCCTCTGG - Intronic
1152754231 17:82080438-82080460 GGCTCTGCTGGGCCTGCAGCTGG + Exonic
1152792293 17:82287844-82287866 GCCCCCGATGTGACTGCATTTGG + Intergenic
1152814160 17:82397656-82397678 GGCACTGCTGTGTCTGCAGCAGG + Intronic
1152942258 17:83178835-83178857 CCCCCGGCTGTGACTGCTGTGGG - Intergenic
1153925157 18:9828985-9829007 CCTCCTCCTGTGACAGCAGCAGG - Intronic
1154010169 18:10567545-10567567 GGCCCTGCTGTGACATAAGCAGG + Intergenic
1154444584 18:14424695-14424717 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1154939112 18:21093279-21093301 GCAAATGATGTGACTGCAGCTGG - Intronic
1156386213 18:36607306-36607328 ACCCCAGCTGTGACTCAAGCAGG - Intronic
1159334439 18:67044471-67044493 GCTCCCTGTGTGACTGCAGCTGG - Intergenic
1160919191 19:1511956-1511978 GCCACTGCTGAGGCTGGAGCAGG + Intronic
1161170690 19:2811003-2811025 GCCTCTGCTTTGAATGAAGCTGG + Intronic
1161345749 19:3768073-3768095 GACCACGCTGTGACTGCAGCAGG - Intronic
1161410060 19:4112186-4112208 GCCCCTTCACTGACTGCACCTGG - Intronic
1162516008 19:11148160-11148182 GCCCCTGCGCTAACTGCAGCTGG + Intronic
1162626331 19:11887928-11887950 ACACCTCCTGTGACTACAGCAGG - Exonic
1162907036 19:13830288-13830310 CACTCTGCTGCGACTGCAGCTGG + Exonic
1163408056 19:17135979-17136001 GGCCCTGGGGTGTCTGCAGCAGG - Intronic
1163640940 19:18461628-18461650 GCTGCTGCTGCGACTGCAGAAGG - Exonic
1163941699 19:20501173-20501195 TCCTCTGCTGCGACTCCAGCTGG + Intergenic
1165642136 19:37398668-37398690 GCCTCTGCTGTGGCTCAAGCTGG - Intergenic
1166382148 19:42360813-42360835 GCCCATGCTGTGGCAGCAGTCGG + Exonic
1166456851 19:42948977-42948999 GCCCCTGCCCTGACTCCACCCGG - Intronic
1166493720 19:43282910-43282932 GACCCTGCCCTGACTCCAGCCGG - Intergenic
1167297726 19:48661742-48661764 GCCCCTGAAGCGGCTGCAGCAGG - Exonic
1167511508 19:49897579-49897601 GCCCCTGCGGCCACAGCAGCTGG - Intronic
1167788105 19:51652319-51652341 GAACCTGCTGTGCCTGAAGCCGG + Intergenic
925017786 2:544820-544842 GCCCCTCCTGGCCCTGCAGCTGG + Intergenic
925129571 2:1484799-1484821 GCCCGGGCTGTGGCTGCACCAGG + Exonic
925141189 2:1550795-1550817 GCCGGTGCTGTCACTGCAGGAGG - Intergenic
925692092 2:6535763-6535785 TCCCCTGCTGTAAATTCAGCCGG - Intergenic
925778815 2:7360645-7360667 GCCCCAGCTCTAGCTGCAGCAGG - Intergenic
927577072 2:24208822-24208844 GCCCCTGCAGGGACTGTAGCAGG + Intronic
928617343 2:33053755-33053777 GGCCCTGCTTTGCCTACAGCAGG - Intronic
930028702 2:47045304-47045326 GGCCCTGCTGTGACTGGTGTTGG - Intronic
930725890 2:54681007-54681029 GCCCTTGCTGCAAGTGCAGCTGG + Intergenic
931700338 2:64903906-64903928 GCCCCTGATGAAACTTCAGCAGG - Intergenic
932395518 2:71444468-71444490 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
933277932 2:80302958-80302980 GCACCTGCAGTCCCTGCAGCTGG - Exonic
933998210 2:87685533-87685555 GCCCCTGGTCTCACTGCTGCAGG + Intergenic
934035073 2:88082460-88082482 GCCCCTGCGGTGCCCTCAGCTGG + Intronic
936111859 2:109671283-109671305 GCCCCTGCCCTGGCTGCAGCTGG - Intergenic
936295640 2:111265340-111265362 GCCCCTGGTCTCACTGCTGCAGG - Intergenic
937152243 2:119693777-119693799 GTGTCTTCTGTGACTGCAGCTGG - Intergenic
937334110 2:121050404-121050426 GCCACTGCTGCGACTGGAGCAGG - Intergenic
937371081 2:121297689-121297711 GCCTTTTCTGTGAATGCAGCAGG + Intergenic
937912983 2:127085179-127085201 GCCCCAGCTGTGGCTGCAAAGGG + Intronic
940267443 2:151854087-151854109 GCCACTGCTGTAACTGCATTTGG + Intronic
944060462 2:195566437-195566459 GCCCCTTCTCTTACTGTAGCTGG - Intergenic
945436177 2:209820539-209820561 GGCCCTGCTGTTAGTGGAGCTGG + Exonic
946059197 2:216927270-216927292 ACCCCTCCTGTGAGTGCAGGTGG + Intergenic
946153253 2:217790183-217790205 ACACCTGCTGATACTGCAGCAGG + Intergenic
946268375 2:218568477-218568499 GCCCCTGCCGTGACTGTAGTAGG + Intergenic
947463678 2:230323647-230323669 GCCCCTGTTGTATCTGCAGCTGG - Intergenic
947653085 2:231803733-231803755 AGCCCTTCTGTGACTGCAGAAGG + Intronic
947716117 2:232339653-232339675 GGATCTGCTGTGCCTGCAGCTGG + Intronic
948102966 2:235390044-235390066 ACCCCTGATGTGACTGCATTTGG - Intergenic
948463473 2:238141312-238141334 GCTCCGGCTGTACCTGCAGCAGG - Exonic
1170937520 20:20823028-20823050 GCCCCAGCTGTGCCTTCAGAAGG + Intergenic
1171055075 20:21898630-21898652 CCCAATGCTCTGACTGCAGCTGG + Intergenic
1172502066 20:35434475-35434497 GGCCCAGCTGTGCCTGGAGCTGG - Exonic
1172702696 20:36862930-36862952 GCGCCTGCTGGGCCTGGAGCTGG - Exonic
1173078069 20:39839690-39839712 GTGCCTGCTGTGTCTGCAGTGGG - Intergenic
1175564051 20:59958774-59958796 GCTGCTGCTGTGGCTGCTGCAGG + Exonic
1175873860 20:62220430-62220452 GCCCCTGCGCTCACAGCAGCTGG + Intergenic
1176973565 21:15292096-15292118 GTTCTTGCTATGACTGCAGCTGG - Intergenic
1178804016 21:35823700-35823722 GCCCCTGCTGAGGCTGGAGACGG - Intronic
1179060097 21:37971901-37971923 GACCCTCCAGAGACTGCAGCAGG - Intronic
1180032822 21:45223952-45223974 ACGCCTGCTGTGACTGCTTCAGG - Exonic
1181973498 22:26711557-26711579 GCTGCTGCTGCTACTGCAGCAGG - Intergenic
1182031043 22:27159702-27159724 GCCCCATCTGTGACTGGAGAAGG + Intergenic
1182445111 22:30385471-30385493 GCCCCTGCTGCCACTGTGGCTGG - Intronic
1182690623 22:32159153-32159175 GCCTCAACTGTGACTGCTGCAGG - Exonic
1183012520 22:34958529-34958551 GCCCCTGCTGTGATTTCAGGAGG - Intergenic
1183251659 22:36734437-36734459 GCCTGTGCTGGGGCTGCAGCAGG + Intergenic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1183582366 22:38733599-38733621 GACCCTTCTGTGTGTGCAGCAGG + Intronic
1184288097 22:43483328-43483350 CCCCCAGCTGTCACTGCAGATGG + Intronic
1184383389 22:44160522-44160544 ACCCCAGCTGTGACTGCAGTAGG - Intronic
1184449058 22:44572159-44572181 GCCACTGCTGTGGTTCCAGCCGG - Intergenic
1184717135 22:46288680-46288702 GCCCCGCCTGTGAGTGCAGCAGG + Intronic
1184838050 22:47035676-47035698 GACCCTGCTGTGGCGGGAGCTGG - Intronic
1185231847 22:49688113-49688135 GCCTCTGCTGTGACTGCGTGGGG + Intergenic
1185344623 22:50305879-50305901 GGCCCTGCTGAGCCTGCAGTGGG - Intronic
950428059 3:12935248-12935270 GCCCCTCCTGGGACTGCTGGTGG - Intronic
950604253 3:14064397-14064419 GCTGCTGCTGTGGCTGCTGCTGG - Exonic
951865554 3:27303038-27303060 GACCCTGGGCTGACTGCAGCTGG - Intronic
952967563 3:38630713-38630735 GCCTCTGCTGTGACAACAGCTGG - Intronic
953846519 3:46431576-46431598 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
954424795 3:50437700-50437722 GCTCCTGCTGGGCCTGCAGGTGG - Intronic
954635624 3:52069320-52069342 GCACCTGCTGTTCCTGCTGCTGG - Intergenic
954695515 3:52422866-52422888 GCCTCACCTGTGGCTGCAGCAGG - Exonic
955365423 3:58306319-58306341 GGCCCAGCTGTGGCTGCTGCCGG + Exonic
956741841 3:72281482-72281504 GCCCCTGCTGAGGAAGCAGCTGG - Intergenic
957857319 3:85895133-85895155 ACGCCTGCTATGAATGCAGCTGG + Intronic
958424336 3:93963947-93963969 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
958497504 3:94864019-94864041 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
962526053 3:136238429-136238451 GACCTTGCTGTGACTGCTTCTGG - Intergenic
963596348 3:147330910-147330932 AGCCCTGCTGTGAATGTAGCTGG - Intergenic
965419135 3:168435506-168435528 GCTGCTGCTGTTACTGCTGCTGG - Intergenic
967882831 3:194313979-194314001 GCCCCAGCTGTGACAGCCTCAGG + Intergenic
968672203 4:1857621-1857643 GCCCCTGCTGTCCATGCAGTCGG + Intergenic
968756086 4:2417355-2417377 GGCCCTGCTCCGGCTGCAGCGGG + Intronic
968811525 4:2801568-2801590 CCCTCTGCTGGGGCTGCAGCAGG - Intronic
970894251 4:21084071-21084093 GCTTCTGCTGTGGCTCCAGCAGG + Intronic
972629021 4:40827555-40827577 GCCACTGCTGTGGCTGCCGCTGG - Intronic
973659159 4:53084633-53084655 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
974456069 4:62130705-62130727 GCACCTGTTATGACAGCAGCTGG - Intergenic
975097914 4:70478706-70478728 GGACCTGCTCTGACTGAAGCAGG - Intronic
976469145 4:85407104-85407126 GCCTCTGTTGTCACTGCAGAAGG + Intergenic
981615452 4:146639358-146639380 GCCGCTGCTGCCACTGCTGCTGG - Exonic
981723540 4:147825042-147825064 GCCCTCCCTGTCACTGCAGCTGG + Intronic
982254280 4:153436914-153436936 GCACCTGCTGTAATGGCAGCTGG + Intergenic
983303471 4:165956831-165956853 TCCTCTGCTGTGGCTCCAGCCGG + Intronic
983398528 4:167234085-167234107 GCCGCGGCGGTGGCTGCAGCCGG - Exonic
985362441 4:189190026-189190048 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
986568524 5:9140547-9140569 CTCCCTGCTGTGACTCCACCTGG + Intronic
986617849 5:9638588-9638610 CCCCCTGCTACTACTGCAGCTGG - Intronic
987397866 5:17442894-17442916 GCACCTCATGTGACTGAAGCAGG + Intergenic
987510307 5:18828713-18828735 GCTCAGGCTGTGACTTCAGCAGG + Intergenic
990518433 5:56553028-56553050 GCTGCTGCTGTGACTGTGGCAGG + Intronic
990866937 5:60390173-60390195 GCTCCTCATGTGACTCCAGCAGG - Intronic
991264045 5:64696039-64696061 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
992503317 5:77362853-77362875 GCCCCCTCTGTGACTGCCCCCGG + Intronic
992758597 5:79932209-79932231 GCCTCTGCCATGTCTGCAGCTGG - Intergenic
995187466 5:109287269-109287291 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
997450300 5:133977173-133977195 TCCCCAGCAGTGGCTGCAGCAGG - Intronic
997452176 5:133992566-133992588 GACCCTGCTGGGAGTGCAGGTGG - Intronic
997613319 5:135230144-135230166 GCCCCAGGTGTGGCTGCAGAAGG + Intronic
997631786 5:135374226-135374248 ACCTCTGCTGTCTCTGCAGCAGG - Intronic
998216508 5:140241745-140241767 GGCCCTGGGGTCACTGCAGCAGG - Intronic
999119499 5:149198303-149198325 GCACCCGCTGTGACAGCTGCCGG + Exonic
1000701609 5:164457947-164457969 CCCCCACCTGTGACTCCAGCAGG + Intergenic
1001666607 5:173438396-173438418 GCCCCTGATCTGTCTGCACCTGG - Intergenic
1002789659 6:427861-427883 GCCCCTCCTTTGACTGTGGCAGG + Intergenic
1003414193 6:5893513-5893535 ACCTCAGCTGTGGCTGCAGCTGG + Intergenic
1006681233 6:35798089-35798111 GCCCCTGGTGTGAGGGCAGGGGG - Intergenic
1008065845 6:47047275-47047297 GCACCTCCTGTGATTGCAGGGGG - Intergenic
1008239161 6:49087452-49087474 GCTCCAGCTGTGACTGCAAATGG + Intergenic
1009399602 6:63238573-63238595 GGCCTTGCAGTGATTGCAGCTGG + Intergenic
1010776455 6:79891721-79891743 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1010816663 6:80365833-80365855 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1012964406 6:105657699-105657721 GCTCCTGCTGTGGCTCAAGCAGG + Intergenic
1013226841 6:108125303-108125325 GCCTCTGCTGTGCCCGCAGTTGG + Intronic
1015804205 6:137092154-137092176 GCCCCTGTTGTTGCTGCAGATGG + Intergenic
1016767910 6:147815542-147815564 GTCCCTGCTGTGTCTGCCTCAGG - Intergenic
1017740462 6:157402040-157402062 TCACTTGCTGTGACTTCAGCAGG - Intronic
1018102209 6:160450759-160450781 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1018642263 6:165915551-165915573 TCCCCTGCTGGGAGTGGAGCTGG + Intronic
1019180490 6:170184540-170184562 GCCCCTCCTGTGGCTCCGGCGGG - Intergenic
1019452491 7:1106964-1106986 GGTCCTGCTGGGACTGCACCAGG + Intronic
1019554311 7:1621053-1621075 GCCCCCATTGTGACCGCAGCGGG + Intergenic
1019974308 7:4568305-4568327 GATCCTGCTGTCACTCCAGCTGG - Intergenic
1021176858 7:17459536-17459558 ACCTCTGCTGTGGCTCCAGCCGG + Intergenic
1023445268 7:40224963-40224985 GCCCCAGCTGTGTCTGCAGTGGG + Intronic
1023494264 7:40777833-40777855 GCCCCTGCCCTTGCTGCAGCTGG - Intronic
1023710934 7:42992075-42992097 GCCCCTACCGTGTCTGCTGCTGG + Intergenic
1024349223 7:48346876-48346898 ACCCCTGCTGTCACTGCTCCAGG - Intronic
1024667247 7:51559273-51559295 GCCACTGCTGGGACTGAAGCAGG - Intergenic
1026953966 7:74365267-74365289 GCCCCCATGGTGACTGCAGCTGG - Intronic
1027734372 7:81914405-81914427 GCTGCTGCTGAGTCTGCAGCGGG + Intergenic
1027864964 7:83633728-83633750 GGCCCAGCTGCTACTGCAGCCGG - Intronic
1031027751 7:116699091-116699113 GCCCCCGCTGTGCTTGCACCTGG + Exonic
1031085473 7:117298042-117298064 CCACCTGCCCTGACTGCAGCAGG + Intronic
1032079218 7:128850309-128850331 ACCCATGCTATGACTGAAGCTGG - Intronic
1032491977 7:132330602-132330624 GCCCCAACTGTGTCTGCATCTGG + Intronic
1032734618 7:134680447-134680469 GAACCTGCTCTGCCTGCAGCTGG + Intergenic
1033499779 7:141936348-141936370 TGCCATGCTGTCACTGCAGCAGG - Intronic
1034442038 7:151090604-151090626 GCCACAGCTGTGACTGCAGTTGG + Intronic
1035279802 7:157770729-157770751 GACCTTGCTGTGTCTGGAGCTGG - Intronic
1038038939 8:23707711-23707733 GCCCCTGCTGTTACTACTCCTGG + Intergenic
1038461226 8:27718685-27718707 ACCCCTGTTGTGTCTTCAGCTGG - Intergenic
1039887499 8:41663554-41663576 TCACCTGCTGTGAGGGCAGCAGG + Intronic
1040284694 8:46093800-46093822 GTCCCTGGGGTGACTGCAGGTGG + Intergenic
1040926351 8:52687947-52687969 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1041300358 8:56405074-56405096 GCCCCAGCTGTGTCTCAAGCAGG + Intergenic
1041381993 8:57260589-57260611 GGCCCTGCGGTCCCTGCAGCTGG - Intergenic
1041550112 8:59090968-59090990 CCACCAGCTGTGACTCCAGCAGG + Intronic
1042143939 8:65707886-65707908 GCCTCTGCTATGAGGGCAGCAGG - Exonic
1042191440 8:66191632-66191654 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1046932495 8:119855627-119855649 GCCCACGCTGTGCCAGCAGCTGG - Exonic
1048295914 8:133213087-133213109 GCCTCTACTGTGACTACAGCGGG + Exonic
1049359289 8:142204319-142204341 GCCCCAGCTGTGTCTGGTGCCGG - Intergenic
1049586999 8:143436885-143436907 GGCCCTGCTGGGATTCCAGCCGG - Intergenic
1049608494 8:143541145-143541167 GGCCCTGCTGGGGCTGCAGAGGG - Intronic
1050003129 9:1099556-1099578 GCCTCTTCTGTGACTTCTGCTGG + Intergenic
1050067171 9:1771969-1771991 GCCCCAGGTGTGACTCCAGTGGG - Intergenic
1053104253 9:35396822-35396844 TCTCCTGCTGTGGCTGCAGGTGG + Exonic
1053139424 9:35673589-35673611 TCCCCTTCTGTGCCTGGAGCTGG + Intronic
1053344948 9:37371395-37371417 GCTCCTGCTGTGTTTGGAGCTGG - Intergenic
1053646432 9:40122373-40122395 GGCCCTGCTGCTACTGCTGCTGG + Intergenic
1053759281 9:41341178-41341200 GGCCCTGCTGCTACTGCTGCTGG - Intergenic
1054327444 9:63720275-63720297 GGCCCTGCTGCTACTGCTGCTGG + Intergenic
1054538137 9:66253600-66253622 GGCCCTGCTGCTACTGCTGCTGG - Intergenic
1056762559 9:89425621-89425643 GCCCCTGATGTCAAAGCAGCGGG - Intronic
1056810082 9:89757364-89757386 GGTCCTGCTGGGACTGCAGCTGG + Intergenic
1057571391 9:96206895-96206917 GCCTCTGCAGACACTGCAGCAGG + Intergenic
1058784539 9:108374405-108374427 GCCCCTTCTACTACTGCAGCTGG - Intergenic
1060159158 9:121344286-121344308 TCCCCTGCTATGAGAGCAGCAGG + Intronic
1060406972 9:123377627-123377649 GCTCCTGCTGTGGAGGCAGCTGG + Exonic
1060530029 9:124342563-124342585 GCCCGTGCTTGGCCTGCAGCTGG - Intronic
1060667955 9:125444268-125444290 GGTCCTGCTTTGACTGAAGCAGG + Intronic
1060965793 9:127711752-127711774 GGCCTGGCTGTGTCTGCAGCTGG + Intronic
1061050106 9:128190413-128190435 GCGGCTGCTGTGGCTGCTGCGGG + Exonic
1061375191 9:130219924-130219946 GTCCCAGCTGTGTCTGCAGAGGG + Intronic
1061422409 9:130479536-130479558 GCCCCTTCTCTCCCTGCAGCAGG + Intronic
1061634590 9:131899260-131899282 GCCCCAGTTGTGACAGCAGGAGG - Intronic
1062336872 9:136075152-136075174 GCCCCAGGTGTGGGTGCAGCAGG + Intronic
1062357177 9:136170513-136170535 GCCCCTGCTGGGTCTACAGAGGG - Intergenic
1062423706 9:136496583-136496605 GCACCTGCTGGGTCTGCACCAGG + Exonic
1062467314 9:136687017-136687039 CCCCCTCCTGTGCCTGCCGCCGG + Intronic
1062547772 9:137071293-137071315 GCCTCTGCTGTGTTTCCAGCTGG + Intergenic
1062592664 9:137281132-137281154 GCCCGGGTTGGGACTGCAGCGGG - Exonic
1062604410 9:137338988-137339010 GGCTCTGCTGTGTCTGCAGCTGG - Intronic
1185488811 X:503745-503767 GCCACTGCTGTGCTTGCTGCTGG + Intergenic
1189908809 X:45789104-45789126 GCCCCTGCTCTGGATCCAGCTGG + Intergenic
1190062815 X:47221966-47221988 GGCCCTGCTGTGAGTCCAGATGG + Intronic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1190710310 X:53063294-53063316 GCCCCTGCTGTGGCTCAAGCAGG - Intronic
1192713324 X:73615242-73615264 GCCCCAGTGGTGACAGCAGCGGG + Intronic
1194382963 X:93218181-93218203 GTCACTGCTTTGACTGAAGCAGG - Intergenic
1194467044 X:94246106-94246128 GCTCCAGCTGTGACTGAAGAGGG + Intergenic
1194950490 X:100120216-100120238 GTCCATGCTGTGACTCCAGATGG - Intergenic
1196473677 X:116058315-116058337 GCTGCTGCTGCCACTGCAGCTGG - Intergenic
1197474251 X:126901079-126901101 GCCACTGCTGTGAAGGAAGCTGG + Intergenic
1200725277 Y:6662640-6662662 TCCTCTGCTGTGGCTCCAGCCGG - Intergenic
1200846175 Y:7833965-7833987 CTCTCAGCTGTGACTGCAGCAGG + Intergenic
1201073188 Y:10168766-10168788 GCTCCTGGTGGGGCTGCAGCCGG - Intergenic