ID: 1141076911

View in Genome Browser
Species Human (GRCh38)
Location 16:81015040-81015062
Sequence GGTGAATTATTTTCACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141076911 Original CRISPR GGTGAATTATTTTCACCTCA AGG Intronic
900866931 1:5275560-5275582 GGGTAATTTTTTTCACCTCCCGG - Intergenic
903644318 1:24884759-24884781 GGAGAATTATTTTCAATTCTAGG + Intergenic
904345320 1:29864506-29864528 GGTTTATTTTTTTCACCTAAAGG + Intergenic
905768203 1:40620740-40620762 TGTGAAGAATTTTCTCCTCAAGG + Exonic
907268829 1:53278563-53278585 GTTGAATTTTTTTCCCCTCCTGG + Intronic
908878742 1:68707239-68707261 GGTCAGTCATTTTAACCTCATGG - Intergenic
909787439 1:79633012-79633034 GTTAAATTCTTTTCCCCTCAAGG + Intergenic
910957577 1:92723805-92723827 GCTGAATTATTTTCCCAGCAAGG + Intronic
911768911 1:101714304-101714326 TGTGAAATATTTTTACCACAGGG - Intergenic
915447832 1:155984221-155984243 GGTGAATTCTATGCAGCTCAGGG + Intronic
916122029 1:161537194-161537216 GCTGAATTCTTTTCCCCACAAGG + Intergenic
916131918 1:161618619-161618641 GCTGAATTCTTTTCCCCACAAGG + Intronic
917255342 1:173109980-173110002 GGAGTATTATTTTCATATCATGG - Intergenic
917281869 1:173385277-173385299 GGTGAATTGTTTTCATAACAAGG + Intergenic
919108735 1:193189962-193189984 GGTGGATGATTTTCATCTAATGG + Intronic
920879538 1:209867009-209867031 GCTGAATTATTTTCCCAGCAAGG + Intergenic
921680384 1:218024049-218024071 TGGGAATTATTTTCACTACAGGG - Intergenic
922182845 1:223249092-223249114 TGTGATTTATTTTCACCTTGTGG - Intronic
923017431 1:230137529-230137551 GAGGAATTATTTTCTCTTCAAGG + Intronic
923772034 1:236946054-236946076 GGGGAAATTTTTTAACCTCATGG - Intergenic
924058523 1:240146942-240146964 GGTGGATGATGTTCTCCTCAGGG + Intronic
1064505757 10:16028010-16028032 GGTTAAATAGTTTCACCTGAGGG - Intergenic
1064558065 10:16567166-16567188 AGTGATATATTTTGACCTCATGG + Intergenic
1064881436 10:20059100-20059122 GGTGATTCATTTGCACCTCGAGG + Intronic
1066658567 10:37718198-37718220 GCTGAATTATTTTCCCAGCAAGG + Intergenic
1068041251 10:51826941-51826963 GGTGGTTTATTTTTTCCTCAGGG - Intronic
1071145356 10:82563310-82563332 GTTGACATATTTTCCCCTCAGGG + Intronic
1071175265 10:82918725-82918747 GGTTATTTATTTTCAACTCCTGG + Intronic
1071762418 10:88623586-88623608 GGAGACTTATTTTTCCCTCATGG - Intergenic
1073335550 10:102705426-102705448 GGAGAAGTATTCTCACCTCCTGG + Exonic
1073806389 10:107103298-107103320 GGCCAATTATTTGCACATCAAGG - Intronic
1074518166 10:114190978-114191000 GGTGAATTACTTTCAGCACTTGG - Exonic
1077943367 11:6868272-6868294 GGTGAATAATTTGAACTTCAAGG - Intergenic
1079563959 11:21858047-21858069 GGTGACTTATTTTCAGCAGATGG + Intergenic
1079783289 11:24637551-24637573 GCTGAATTCTTTTCCCTTCAAGG + Intronic
1081371685 11:42312119-42312141 GGTGAATCATGTTTGCCTCATGG - Intergenic
1081386228 11:42476802-42476824 GGTTAATAATTTTCACCCCCAGG + Intergenic
1081777641 11:45686673-45686695 GGAGAATTATTTTTTCTTCAGGG - Intergenic
1085733964 11:79023249-79023271 GGTGAATTATATTCAAATCAAGG + Intronic
1086456132 11:86960535-86960557 GGTGGATTATTTTGAGCTCAAGG - Intergenic
1086586105 11:88453878-88453900 GGTGAAATATTAACACCTTAAGG + Intergenic
1087528662 11:99351297-99351319 GGCCAATAATTCTCACCTCACGG - Intronic
1087999520 11:104859432-104859454 GGTGAAATATTTTCTCTTGAGGG - Intergenic
1088995365 11:114991147-114991169 GGGGAATTGTTTTAATCTCAAGG - Intergenic
1089904163 11:122021079-122021101 TGAAAATTGTTTTCACCTCATGG + Intergenic
1093560860 12:20538271-20538293 AGGGAATTATCTTCCCCTCATGG + Intronic
1096727157 12:53573738-53573760 GGTAAAGTATTTTCTCCTGAGGG - Intronic
1096999141 12:55861662-55861684 GGTGAATTCTTTTCTTCCCAAGG + Intergenic
1098648229 12:72932214-72932236 GCTGAATTATTTTCCCAGCAAGG - Intergenic
1098886503 12:75965972-75965994 GGTGTTCTATTTTCACCTCATGG + Intergenic
1100439907 12:94607093-94607115 GCTGAATTATTTTCCCAGCAAGG - Intronic
1100782503 12:98044237-98044259 GGTGCATTATCTACACCTTACGG - Intergenic
1107454797 13:40545356-40545378 GTTGAATAATTATCAGCTCATGG - Intergenic
1107572573 13:41678469-41678491 GTTGAATTATTTATAGCTCAGGG + Intronic
1108112960 13:47096675-47096697 GGTGAATTATTTTCAAGATAAGG + Intergenic
1109202191 13:59442973-59442995 GGTAAATTATGTTCACATTATGG + Intergenic
1109381951 13:61574162-61574184 GTTGAATTATTTTCACTTTTTGG - Intergenic
1109763967 13:66868754-66868776 GGTAAATTTTGTTCACTTCAAGG + Intronic
1110020965 13:70471491-70471513 GGTGCATTATCTTCATCACAAGG + Intergenic
1110748519 13:79084989-79085011 TGTTAATTATTTTCACATAATGG - Intergenic
1110990368 13:82035438-82035460 GTTGAAATACTTTCACTTCAGGG - Intergenic
1112712305 13:102143529-102143551 TGTGTATTTTTTTCCCCTCAGGG - Intronic
1113027421 13:105956508-105956530 GCTGAATTATTTTAATCTCTTGG - Intergenic
1116610306 14:47061489-47061511 GGCAAGATATTTTCACCTCACGG + Exonic
1116672963 14:47867131-47867153 GCTGGATTATTTTCTCCTCTTGG + Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1122001993 14:98666327-98666349 TGTTATTTTTTTTCACCTCAAGG + Intergenic
1124453046 15:29815658-29815680 GGTGAATTTTTATCATATCAGGG + Intronic
1127399425 15:58571622-58571644 GGTGGATTATTTTCACTTGGAGG + Intergenic
1130328935 15:82904562-82904584 GGTAAATTAGTTTCTCCTGAGGG - Intronic
1131654230 15:94438339-94438361 TGTGAATTTTTTCCACCTCAGGG - Intronic
1133510273 16:6451576-6451598 GGTGAATTATTTCCAGGTGAAGG - Intronic
1133764106 16:8823720-8823742 GGTGAAATTTTTTCTTCTCATGG + Intronic
1138243483 16:55447684-55447706 GCTTAATCATTTGCACCTCAAGG - Intronic
1138850584 16:60624542-60624564 GGTGATTTATGTTGACCACATGG + Intergenic
1138895184 16:61195855-61195877 CGTGAGTTATTTTGAACTCATGG + Intergenic
1139408514 16:66739324-66739346 TCTGAACTATTTTCTCCTCATGG - Intronic
1141076911 16:81015040-81015062 GGTGAATTATTTTCACCTCAAGG + Intronic
1143088267 17:4433247-4433269 GGTGATTTATTTTAACCCCTTGG + Intergenic
1146979711 17:37149019-37149041 GGAAAATTATTTTCTCTTCAGGG - Intronic
1148453603 17:47798056-47798078 GAGAAATTATTTTGACCTCAGGG - Intergenic
1150818711 17:68417284-68417306 GGTAAATTAGTTTCTCCTGAGGG + Intronic
1152358899 17:79821022-79821044 GGTGAATTATTTTGTCATGACGG - Intergenic
1153937051 18:9936917-9936939 GGTAAGTAAGTTTCACCTCACGG - Intronic
1156131030 18:33974897-33974919 GTTGAATTGCTTTCACCTCTTGG - Intronic
1156264061 18:35469951-35469973 AGTGAATTATTTTCTCCGCTTGG - Intronic
1156993546 18:43439430-43439452 GCTGAATTATTTTCCCAGCAAGG + Intergenic
1158411399 18:57208997-57209019 CATGAATTATTTTCACCACGTGG - Intergenic
1160042234 18:75356400-75356422 GGGAAATCATTTTGACCTCATGG + Intergenic
1161602607 19:5193702-5193724 GTTGAATTATTTTCATTTCCAGG + Intronic
1163274927 19:16277505-16277527 GGTGAGTAATTCACACCTCACGG + Intergenic
1164198951 19:23000901-23000923 GTTCACTTATTTTGACCTCAGGG - Intronic
1168636176 19:57999186-57999208 GATGCATTCTTTTCACCTCTTGG + Intronic
925616501 2:5748842-5748864 GGTGAAATATTTCCTCCTGAGGG + Intergenic
925622017 2:5803539-5803561 GCTGAGTTATTGTCACCTCTGGG - Intergenic
928707224 2:33963304-33963326 GATGAATTAGTTTCATCACAAGG - Intergenic
928800285 2:35081381-35081403 GGAGAGTCATTTTCACATCATGG + Intergenic
929010777 2:37441934-37441956 AGTGAATTATTTAAACCTGAAGG + Intergenic
929489285 2:42382192-42382214 TGTGAATTATTTTCCCCCAAAGG + Intronic
930460022 2:51662094-51662116 TGTGAATTATTTTGAGCTAAAGG + Intergenic
932139119 2:69260123-69260145 GCTGAATTCTTTTCCCCGCAAGG + Intergenic
933036112 2:77400639-77400661 GGTGAATTATGTACTCCTCCGGG + Intronic
934865428 2:97805688-97805710 GATGAACTATTTTCCCCTGAAGG + Exonic
935939653 2:108224869-108224891 GGTGAATTCTTCTCTTCTCAAGG - Intergenic
936991268 2:118369126-118369148 TGTGAATAATTTTCCCCACATGG - Intergenic
936997786 2:118433653-118433675 GCTGAATTTTTTTAACCTCTTGG + Intergenic
939383035 2:141460797-141460819 GGTGAATTTTTTTAAAGTCAGGG + Intronic
942243295 2:173983889-173983911 TGTGACTTATTTTTACCTCGAGG + Intergenic
942582311 2:177431636-177431658 GCTGAATTATTTTCCCAGCAAGG - Intronic
942910436 2:181237180-181237202 GGTGAGTTATTTTCAGTTCCTGG - Intergenic
945309503 2:208294791-208294813 GGTAAAATAGTTTCTCCTCAGGG + Intronic
946603069 2:221372759-221372781 GGTGAATTTCTTTCTCCTCAAGG - Intergenic
1170007966 20:11689429-11689451 GGTGAATTATTTCCAAATGAGGG - Intergenic
1170355173 20:15484573-15484595 GGTGAAATATTTTCTCTTGAAGG + Intronic
1173662082 20:44741786-44741808 AATGGATTATTTTAACCTCAGGG - Intergenic
1174683614 20:52431958-52431980 GGTAATTTATTCCCACCTCATGG - Intergenic
1176706368 21:10122121-10122143 GGTGCATCACCTTCACCTCATGG - Intergenic
1177213254 21:18096442-18096464 GCTGAATTATTTTCCCAGCAAGG + Intronic
1179334185 21:40434613-40434635 GTTTAATTATTTCCACCTGATGG - Intronic
1179938979 21:44626281-44626303 GATGAATTGTTATCACCACAGGG - Intronic
1183179482 22:36249706-36249728 GGTGAGTTCCTTTCTCCTCAAGG - Intergenic
1184800374 22:46755267-46755289 GATCAATTATTTTCACATCCAGG - Intergenic
951974382 3:28487955-28487977 GGTAAAATAGTTTCTCCTCAGGG + Intronic
953990900 3:47482634-47482656 GGAGAATTAACTTCACCTCAGGG + Intergenic
954218952 3:49140870-49140892 GCTGAATTATTTTCCCAGCAAGG + Intergenic
955074373 3:55599780-55599802 AATTATTTATTTTCACCTCAAGG + Intronic
957201324 3:77139845-77139867 GGTCAATCATTTTCCCATCAAGG + Intronic
957743263 3:84303204-84303226 GTTGAATTATTTTGAACCCATGG + Intergenic
959999126 3:112712515-112712537 GGTGAATGAATTTCAGCCCATGG - Intergenic
961919176 3:130408213-130408235 GCTGAATTATTTTCTCAGCAAGG + Intronic
962754901 3:138459574-138459596 CGAGAGTTATTTTCACCTCCTGG - Intronic
964358792 3:155872709-155872731 GGTGAATTAATTTTATTTCAAGG + Intronic
965017635 3:163178608-163178630 GTTGAATTATCTTCTCCTCAGGG + Intergenic
965068119 3:163878710-163878732 GCTGAATTATTTTCCCAGCAAGG - Intergenic
967280855 3:187822338-187822360 GGTTAATTCTCTTCACCTCTTGG - Intergenic
969849419 4:9944537-9944559 GGTGGATTCTTTAAACCTCAGGG + Intronic
971074826 4:23135361-23135383 GGAGAATTTATTTCACCTCTTGG + Intergenic
972924729 4:43989930-43989952 AGTGAATTTTATTCACCTCATGG + Intergenic
974607471 4:64172582-64172604 CATGAATTATTTTCACTTCTAGG + Intergenic
974715564 4:65666335-65666357 GGTGAATCATTTTCAATGCAGGG + Intronic
974957344 4:68657810-68657832 GGTCAATTTTTTTTATCTCATGG + Intronic
975819269 4:78253143-78253165 GCTGAATTATTTTCCCAGCAAGG - Intronic
976328168 4:83796467-83796489 GGTGAATTAAGTACATCTCAGGG - Intergenic
976613954 4:87057354-87057376 GGAGAATTATTTTGGCTTCATGG + Intronic
976800170 4:88981622-88981644 GGTGTATTATTTTGACAGCAGGG + Intronic
977327951 4:95601118-95601140 GGGTAATAATATTCACCTCATGG + Intergenic
978523866 4:109644635-109644657 GGTGATTTATTTTCTCCTTTTGG - Intronic
981706127 4:147660830-147660852 ACTGAATTTTTTTCACCTGAAGG + Exonic
982549456 4:156779386-156779408 GGCCAATTATATTCACATCAAGG + Intronic
982754796 4:159205292-159205314 GGTGATTCATTTGCACATCAGGG + Intronic
983482144 4:168288457-168288479 GGTGAATGCTTTACACCTTAAGG + Intronic
983542625 4:168929330-168929352 GATGAAATATTTTCACCTTATGG - Intronic
990530627 5:56669913-56669935 GGTGTTTTATTTTCAGCTCTGGG + Intergenic
991331530 5:65497645-65497667 GTTCAATAATTTTCACCTCCTGG - Intergenic
993238475 5:85346904-85346926 AGGGAATAATTTTCATCTCAGGG - Intergenic
993604643 5:89973652-89973674 GGTTCCTTATTTTCACTTCAAGG + Intergenic
994124577 5:96154973-96154995 GGGGAGCTATTTTCACCTCCTGG + Intergenic
994608816 5:102009071-102009093 GGTGACTTATTTTCTCTTCTTGG + Intergenic
994718701 5:103354946-103354968 GGTAAATTATTTTCTTCTCTTGG - Intergenic
994770144 5:103971739-103971761 GGTTAAATAGTTTCTCCTCAGGG - Intergenic
995590555 5:113695312-113695334 GGTGAATAATTTTCATTCCAAGG + Intergenic
997477827 5:134156986-134157008 TGTGAATAATTTTCTCCACATGG + Exonic
997747602 5:136312678-136312700 GGTGACTTATCTTCATCTAATGG + Intronic
998950172 5:147385767-147385789 GGGGGATTGTTTTCACCTCTTGG + Exonic
1000816665 5:165930902-165930924 TGTTAATTATTTTCAAGTCAAGG + Intergenic
1000902613 5:166928077-166928099 GGTGAAGTCTTTTCCCCTGAAGG - Intergenic
1004927224 6:20427487-20427509 GATCAATTCTTTTCACCTCAGGG + Intronic
1006378272 6:33683738-33683760 GGTGGATTATTTTCCCCACGTGG + Intronic
1007863152 6:44936205-44936227 GGAGAATTTTTTTCACATGAAGG + Intronic
1008116346 6:47555002-47555024 GATGAATCATTTTAAACTCAGGG - Intronic
1008426555 6:51364982-51365004 AGGGAGTTATTATCACCTCAAGG + Intergenic
1009240220 6:61176753-61176775 GGTGAGTTATTCTCTTCTCAAGG - Intergenic
1010958853 6:82122705-82122727 TTTAAATTATTTTCACTTCATGG + Intergenic
1013649222 6:112176972-112176994 GGTGAATTATTTTCTCTGAATGG + Intronic
1013653355 6:112219070-112219092 GATGAAATATTTCCACCTAAAGG - Intronic
1014418125 6:121209111-121209133 GCTGTAATATTTTCATCTCAGGG - Intronic
1014615916 6:123599413-123599435 TCTGAATTATTTACATCTCATGG - Intronic
1014965270 6:127740084-127740106 GGAGAATTATTTCTACCTCAAGG - Intronic
1015341879 6:132110044-132110066 GCTGAATTATTTTCTCAGCAAGG - Intergenic
1019670052 7:2272744-2272766 GGTTAAATATTTTCACTCCAAGG + Intronic
1020416672 7:7953977-7953999 GGTGACTTATTTTCATCTCTGGG - Intronic
1021630869 7:22646405-22646427 GGGGAAATACTTTCACCTCCAGG + Intergenic
1021733109 7:23616566-23616588 GGAAAATTATTTCCATCTCAAGG - Intronic
1023382914 7:39625780-39625802 GTTGGATTATTTTCACATTAGGG + Intronic
1024251171 7:47506751-47506773 GGTGTATACTTTTCATCTCAAGG - Intronic
1024856662 7:53790219-53790241 GGGGAAATATATTTACCTCAGGG - Intergenic
1024964814 7:55014981-55015003 GGTGAAATAATTTCTCCTGAGGG + Intergenic
1025982968 7:66422644-66422666 TGTGAATAATTTTCTCCACATGG + Intergenic
1028439102 7:90838552-90838574 GCTGAATTATTTTCCCAGCAAGG + Intronic
1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG + Intronic
1030690303 7:112525817-112525839 GGTAAATAATTTTTACCTAAAGG + Intergenic
1031166286 7:118231465-118231487 GGTCATTTATTTTCATCTCTAGG - Intronic
1031495556 7:122443224-122443246 GTTGAATTATTTACACATCATGG - Intronic
1033784219 7:144711128-144711150 GAGGAATTATTTTAACCTCCAGG + Intronic
1035023567 7:155812589-155812611 GTTGCTTTATTTTCACCTGAAGG + Intergenic
1035846198 8:2867535-2867557 GCTCATTTATTTTCAGCTCATGG + Intergenic
1037100893 8:15044438-15044460 AGTGAAATATTTTCACCAAAAGG - Intronic
1037576059 8:20204077-20204099 GGGGAATAGTTCTCACCTCAGGG - Intronic
1037651083 8:20839290-20839312 GGTGGGTTATTTCCACTTCATGG - Intergenic
1039605610 8:38877750-38877772 GGCGAGATCTTTTCACCTCAGGG + Intergenic
1040665197 8:49623364-49623386 GGTGAATTCTTTCCTTCTCAAGG - Intergenic
1043777077 8:84283428-84283450 GGGAAATCATTTTCTCCTCATGG - Intronic
1044075530 8:87817911-87817933 GGTGAATTTCTTTCTTCTCAAGG + Intergenic
1044374581 8:91454660-91454682 AGTGACTTAGTTTCATCTCAGGG - Intergenic
1045035745 8:98175273-98175295 CGTGAGTTATTTTCACCTGTTGG - Intergenic
1045620362 8:103970366-103970388 GGTTAATTAGTTTCCCCTGAGGG + Intronic
1046617210 8:116490534-116490556 GCTGAACTATTTTCACTCCACGG + Intergenic
1046664323 8:116982734-116982756 CGTGAAACATTATCACCTCAGGG + Intronic
1047488514 8:125354761-125354783 GGTGAATTAATTGCAACACAGGG - Intronic
1047716054 8:127596314-127596336 GCTAAATTATTTCCACCTTAGGG + Intergenic
1048140761 8:131791894-131791916 GGCGAATATTTTTAACCTCAAGG - Intergenic
1051372994 9:16374173-16374195 GGTAAATAATATTTACCTCATGG - Intergenic
1052125938 9:24774500-24774522 GCTGAATTATTTTCTCAGCAAGG - Intergenic
1053137356 9:35659569-35659591 GGAGAATTGTATTCTCCTCAGGG + Exonic
1054540217 9:66263859-66263881 GGTGACTCACTTTCCCCTCATGG + Intergenic
1055885511 9:81058675-81058697 GGGGAATTATATACACCTTAAGG + Intergenic
1057018694 9:91678910-91678932 GGTAAATTATGTCCACCTCCTGG + Intronic
1057789705 9:98116446-98116468 GGTGAATTATTCTCTTCTCAAGG - Intronic
1058225435 9:102356084-102356106 GCTGAATTATTTTCCCAACAAGG + Intergenic
1059025447 9:110623540-110623562 GGTGAATGCCTTTCACCTCATGG + Intergenic
1059181631 9:112219378-112219400 GTTGTATTATTTTCACTTCTTGG - Exonic
1059699786 9:116764060-116764082 GGTGCATTTTTTTCACCTCATGG + Intronic
1202791406 9_KI270719v1_random:92210-92232 GGTGCATCACCTTCACCTCATGG - Intergenic
1187923815 X:24232259-24232281 GGTGTCTTGTTTTCACCTCTGGG + Intergenic
1188355704 X:29188131-29188153 GGAGAATGATTTTAACCACATGG - Intronic
1188440183 X:30208802-30208824 CCTGTATTATTTTCTCCTCAGGG + Intergenic
1189581854 X:42414649-42414671 GGTGAATGATTTTGCACTCATGG - Intergenic
1189631915 X:42963154-42963176 GGTGAATTATTATCTTCTCAAGG + Intergenic
1190619608 X:52272202-52272224 GCTGAATTATTTTCTCAGCAAGG + Intergenic
1192842515 X:74871652-74871674 GCTGAATTATTTTCCCAGCATGG - Intronic
1193085421 X:77444628-77444650 GGCAAATTATTCTCAACTCATGG - Intergenic
1193200230 X:78681108-78681130 GGTCAATTAATGTCACCTCCTGG + Intergenic
1193418830 X:81258617-81258639 GGAGAATTATCTTCTCTTCATGG + Intronic
1197549154 X:127866935-127866957 GCTGAATTATTTTCCCAGCAAGG + Intergenic
1198032403 X:132766126-132766148 GTTGAATTAGTTTCACCTTGGGG - Intronic
1199219813 X:145305352-145305374 GCTGAATTTTTTTCTCCTCTGGG + Intergenic
1199860385 X:151796073-151796095 GGTCACTTATTGTCACCTCCAGG + Intergenic