ID: 1141082059

View in Genome Browser
Species Human (GRCh38)
Location 16:81061359-81061381
Sequence CCGTTTCTGCAGAAGCTGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141082055_1141082059 14 Left 1141082055 16:81061322-81061344 CCTTGGCTTTGAATTTGGATTTG 0: 1
1: 0
2: 4
3: 40
4: 328
Right 1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG 0: 1
1: 0
2: 3
3: 11
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141082059 Original CRISPR CCGTTTCTGCAGAAGCTGCA AGG Exonic
900565463 1:3329758-3329780 CCCTCTCTCCAGAAGCCGCACGG - Intronic
900688425 1:3964493-3964515 TCTTGTCTGCAGCAGCTGCACGG - Intergenic
901173398 1:7280439-7280461 AGGTTTCTGCAGAAGCAGCTTGG + Intronic
901713460 1:11134281-11134303 TCCTTGCTGCAGAAGCTGCTGGG + Intronic
903256947 1:22108799-22108821 CCGTTTGGGGAGCAGCTGCAGGG + Intergenic
904681395 1:32231920-32231942 CTGAGCCTGCAGAAGCTGCATGG - Intergenic
905768483 1:40622586-40622608 GTGTTTCTGCAGTGGCTGCAGGG - Exonic
907357330 1:53886967-53886989 CTGTCTCTGCCCAAGCTGCATGG - Intronic
907414457 1:54304595-54304617 CAGTTCCTGCAAAGGCTGCATGG + Intronic
908439662 1:64141303-64141325 CAGCTTCTGCAGAAGGTGAACGG + Intronic
908928427 1:69285871-69285893 CCATTTCTGCATAAACTGCCTGG + Intergenic
912408175 1:109459833-109459855 CAGTTTTTGGAGAAGCTTCATGG - Intergenic
913774312 1:122297581-122297603 CACTTTCTGTAGAATCTGCAAGG + Intergenic
913777249 1:122336770-122336792 CACTTTCTGTAGAATCTGCAAGG + Intergenic
913778228 1:122349817-122349839 CACTTTCTGTAGAATCTGCAAGG + Intergenic
913781723 1:122396472-122396494 CACTTTCTGTAGAATCTGCAAGG + Intergenic
913785911 1:122452291-122452313 CACTTTCTGTAGAATCTGCAAGG + Intergenic
913788287 1:122484205-122484227 CACTTTCTGTAGAATCTGCAAGG + Intergenic
916444144 1:164856328-164856350 CCTTTTCAGCAGAGCCTGCAAGG + Intronic
920933309 1:210408667-210408689 CCTTTCCTGCAGCAGCTGCCTGG - Intronic
921159659 1:212463952-212463974 GTGTTTATTCAGAAGCTGCAGGG + Intergenic
921750134 1:218782611-218782633 CAGCTTCTGCAGAAGCCTCAGGG - Intergenic
923897471 1:238288095-238288117 CCTTGTCTGCAGAAGTTGTAAGG - Intergenic
1063415702 10:5870978-5871000 CAGGTTCTGCAAATGCTGCAGGG + Intronic
1064217776 10:13415091-13415113 CTGTTTCTGCACCAGCTGCATGG - Intergenic
1066799712 10:39171890-39171912 CTGTTTTTGTAGAATCTGCAGGG + Intergenic
1066803187 10:39213015-39213037 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1066808781 10:39296316-39296338 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1066816528 10:39424233-39424255 CTCTTTCTGTAGAATCTGCAAGG - Intergenic
1066819041 10:39460496-39460518 CTCTTTTTGCAGAATCTGCAAGG - Intergenic
1066823718 10:39533237-39533259 CTCTTTCTGTAGAATCTGCAAGG + Intergenic
1066823729 10:39533408-39533430 CTCTTTCTGTAGAATCTGCAAGG + Intergenic
1066823740 10:39533580-39533602 CTCTTTCTGTAGAATCTGCAAGG + Intergenic
1066929911 10:41745043-41745065 CTGTTTATGTAGAATCTGCAAGG + Intergenic
1066932062 10:41775267-41775289 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1068852115 10:61754720-61754742 CCATTCCAGCTGAAGCTGCAAGG - Intronic
1069369382 10:67730465-67730487 CCCTTTCTGAGGAAGCTGCTGGG + Intergenic
1069708145 10:70472162-70472184 CCCTTTATGAAGATGCTGCAGGG - Intergenic
1069801550 10:71084888-71084910 CAGTTCCTGCAGCAGTTGCAGGG - Intergenic
1070330723 10:75415257-75415279 CCTTTTCTTCTGAAGCAGCAGGG - Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074922095 10:118024926-118024948 CCATCTCTGCAGAGGCTTCAAGG + Intronic
1075683350 10:124347824-124347846 GCGTCTGTGCAGAAGCAGCACGG - Intergenic
1075967916 10:126628770-126628792 TGGTTTCTGCAGAAGCTGCAGGG - Intronic
1077185868 11:1235077-1235099 CGGTTCCTGCAGGTGCTGCAAGG - Exonic
1078852298 11:15175902-15175924 CCGTTTGAGCAGCAGCTGCAGGG - Exonic
1079187007 11:18246886-18246908 CAGTTTCTGCAGACTCTGCTGGG + Intronic
1079189796 11:18268013-18268035 CAGTTTCTGCAGACTCTGCTGGG - Intronic
1082156882 11:48832610-48832632 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1082159878 11:48879288-48879310 CGATTTTTGCAGAATCTGCAAGG + Intergenic
1082297843 11:50465181-50465203 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1082301094 11:50507451-50507473 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1082312186 11:50664694-50664716 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1082321739 11:50820290-50820312 CTCTTTCTGTAGAATCTGCAAGG + Intergenic
1082323994 11:51114646-51114668 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082346380 11:51439603-51439625 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082366950 11:51738680-51738702 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082368996 11:51768428-51768450 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082385909 11:52014235-52014257 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082394187 11:52135093-52135115 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082405646 11:52300990-52301012 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082421720 11:52532931-52532953 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082437472 11:52760722-52760744 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082441533 11:52819363-52819385 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082442893 11:52838898-52838920 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082445078 11:52870352-52870374 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082474527 11:53297318-53297340 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082476996 11:53333023-53333045 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082482369 11:53410404-53410426 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082482727 11:53415505-53415527 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082492620 11:53557054-53557076 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082508881 11:53793055-53793077 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082545750 11:54326497-54326519 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1082554310 11:54542092-54542114 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1082593729 11:55048063-55048085 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1082835363 11:57647152-57647174 CCGTCTCTGCGGGGGCTGCACGG - Exonic
1083839287 11:65294567-65294589 CCGTTTATGGAGAGGCTGCAGGG - Exonic
1085533719 11:77206080-77206102 CCGTTTCTGAAAAGGCAGCAGGG - Exonic
1090385231 11:126354656-126354678 CTGCTTCTGCTGAAGCTGGAGGG - Intergenic
1090449478 11:126793524-126793546 GAGTTCCTGCAGAAGGTGCATGG + Intronic
1091316749 11:134619260-134619282 CCTTTCCTGCAGAAGCAGCGTGG + Intergenic
1093970054 12:25368313-25368335 CCTATTCTGCAGAAACTGGAAGG + Intergenic
1094857341 12:34413587-34413609 CTGTTTTTGTAGAAACTGCAGGG - Intergenic
1094863092 12:34493243-34493265 CTGTTTTTGAAGAATCTGCAAGG - Intergenic
1094866690 12:34541523-34541545 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1094866875 12:34544556-34544578 CTGTTTTTGTAGAAACTGCAAGG - Intergenic
1095057022 12:37621201-37621223 CTCTTTCTGTAGAATCTGCAAGG + Intergenic
1095059862 12:37671510-37671532 CTCTTTTTGCAGAATCTGCAAGG - Intergenic
1095072656 12:37874193-37874215 CTGTTTTTGCAAAATCTGCAAGG - Intergenic
1095072937 12:37879316-37879338 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1095074629 12:37902721-37902743 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1095076232 12:37929981-37930003 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1095461194 12:42446094-42446116 CCGTTTCTTCCGGGGCTGCAGGG - Exonic
1096185957 12:49580700-49580722 CCTTTCCTGCAGAAGCCACAAGG - Intronic
1101840745 12:108325883-108325905 CCAGTTCTGCAGAAAGTGCAAGG + Intronic
1103407840 12:120687934-120687956 CCGCTCCTGCAGAAGGGGCAAGG - Intronic
1104836591 12:131795888-131795910 CCTCTGCTGCAGAAGCTGCCAGG - Intronic
1105089161 13:16255466-16255488 CTCTTTTTGCAGAATCTGCAAGG + Intergenic
1105154348 13:17324526-17324548 CTCTTTCTGTAGAATCTGCAAGG + Intergenic
1105160056 13:17417789-17417811 CTCTTTTTGCAGAATCTGCAAGG + Intergenic
1106169037 13:27272879-27272901 CTGCTTCTGCAGAAGCTGGGTGG + Intronic
1108809924 13:54210485-54210507 GCTTTTCTTCAGAATCTGCAGGG - Intergenic
1109213530 13:59562763-59562785 CCGTTCCAGCAGAAGCTGCAGGG + Intergenic
1110336557 13:74338890-74338912 CCTTTTTTCCAGCAGCTGCAGGG - Intergenic
1111003679 13:82219801-82219823 CCATTTCTACAGAAATTGCAAGG + Intergenic
1113533996 13:111049935-111049957 CCACTTCTGCAGAGGCTGCGAGG + Intergenic
1113996814 14:16091298-16091320 CACTTTTTGCAGAATCTGCAAGG - Intergenic
1113996825 14:16091469-16091491 CACTTTTTGCAGAATCTGCAAGG - Intergenic
1114001940 14:18263183-18263205 CTCTTTTTGCAGAATCTGCAAGG - Intergenic
1115715116 14:36094918-36094940 CCATTTCTGCAGTTGCTGCTGGG + Intergenic
1117496705 14:56312715-56312737 CCATTTCTGCAGGAGATGCTAGG - Intergenic
1118740107 14:68733322-68733344 CAGTTACAGCAGAAGCTGGAAGG + Intergenic
1119030434 14:71188111-71188133 CAGCTTCTCCAGAGGCTGCAGGG + Intergenic
1120443568 14:84566293-84566315 CCGTCTCAGGAGAGGCTGCAAGG - Intergenic
1121861815 14:97325710-97325732 CTGTTTCTGCAGGTGCTCCATGG + Intergenic
1122593187 14:102870411-102870433 CCGCTTCTGCGAGAGCTGCATGG + Exonic
1124007540 15:25806908-25806930 CCCTTTCTCCAGAAACTGAAGGG + Intronic
1125536603 15:40444232-40444254 GCATTTCTGGAGAAGCTGAAAGG - Intronic
1125546166 15:40507231-40507253 GCGTCTCTGCAGATCCTGCAGGG - Intergenic
1128392685 15:67193328-67193350 CAGTCTCAGCACAAGCTGCAAGG - Exonic
1131672252 15:94632110-94632132 CCGTGAGTGCAGAAGATGCAAGG - Intergenic
1132004270 15:98212629-98212651 TCTCTTCTGCAGAAGCTGCAAGG + Intergenic
1132761324 16:1509881-1509903 GAGTCTCTGCAGAAGCAGCAGGG - Exonic
1134040019 16:11061176-11061198 CCTTTTCTTCAAAACCTGCATGG - Intronic
1136075376 16:27813668-27813690 CGGGATCTGCAGAATCTGCAGGG + Intronic
1136916342 16:34203032-34203054 CACTTTCTGTAGAATCTGCAAGG - Intergenic
1137079881 16:36035069-36035091 CTGTTTTTACAGAATCTGCAAGG + Intergenic
1138812604 16:60168381-60168403 CAGTTTAGGCAGATGCTGCAAGG - Intergenic
1138872583 16:60909865-60909887 CCGTTTTTGGTGATGCTGCATGG - Intergenic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1142201214 16:88761982-88762004 CCCTTTCTGGAGAGGCTGCGGGG - Intronic
1203013503 16_KI270728v1_random:325333-325355 CTGTTTTTGAAGAATCTGCAAGG + Intergenic
1203031838 16_KI270728v1_random:598492-598514 CTGTTTTTGAAGAATCTGCAAGG + Intergenic
1203039883 16_KI270728v1_random:735939-735961 CTGTTTTTGAAGAATCTGCAAGG - Intergenic
1142987257 17:3703658-3703680 ACGTGTCTTCAGAGGCTGCAGGG - Intergenic
1143186438 17:5013199-5013221 CCAACTCTCCAGAAGCTGCAAGG + Intronic
1143715833 17:8768387-8768409 CCATTTCTGCAGCATCTCCAGGG - Intergenic
1145442828 17:23131093-23131115 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1145447912 17:23201555-23201577 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145452401 17:23267573-23267595 CACTTTCTGCAGAATCTGCAAGG + Intergenic
1145453566 17:23284533-23284555 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145459075 17:23364973-23364995 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145464180 17:23439102-23439124 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145467191 17:23482701-23482723 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145478676 17:23649643-23649665 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145485500 17:23748529-23748551 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145492595 17:23851674-23851696 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145493143 17:23859822-23859844 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145496058 17:23902237-23902259 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145500137 17:23961964-23961986 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145501186 17:23977231-23977253 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145502347 17:23994188-23994210 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145504495 17:24025407-24025429 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145508757 17:24087482-24087504 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145514365 17:24168733-24168755 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145515357 17:24183159-24183181 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145516301 17:24196912-24196934 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145517349 17:24212018-24212040 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145517721 17:24217449-24217471 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145531398 17:24416621-24416643 CTCTTTTTGCAGAAACTGCAAGG + Intergenic
1145539487 17:24534330-24534352 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145540536 17:24549596-24549618 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145555730 17:24770610-24770632 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145556645 17:24783856-24783878 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145562432 17:24867990-24868012 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145562921 17:24875110-24875132 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145567111 17:24936003-24936025 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145567598 17:24943125-24943147 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145571627 17:25001634-25001656 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145572151 17:25009267-25009289 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145572917 17:25020457-25020479 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145575583 17:25059302-25059324 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145575766 17:25062017-25062039 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145577337 17:25084911-25084933 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145580318 17:25128009-25128031 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145593208 17:25315146-25315168 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145595119 17:25343316-25343338 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145600036 17:25415432-25415454 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145601197 17:25432401-25432423 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145606082 17:25503492-25503514 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145611349 17:25579852-25579874 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145617749 17:25673526-25673548 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145624491 17:25771426-25771448 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145631534 17:25873927-25873949 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145631721 17:25876643-25876665 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145645042 17:26069625-26069647 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145657877 17:26255752-26255774 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145658432 17:26263898-26263920 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145678593 17:26557211-26557233 CTCTTTCTGTAGAAACTGCAAGG + Intergenic
1145969602 17:28949410-28949432 TCCTTTCTGCAGAAGCTCCTCGG - Intronic
1146354880 17:32125538-32125560 CAGGTGCTGCAGAAGCAGCAGGG - Intergenic
1147677748 17:42219416-42219438 CTGCTTCCGCAGCAGCTGCAGGG + Exonic
1147688288 17:42300155-42300177 CTGCTTCCGCAGCAGCTGCAGGG - Exonic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1151855446 17:76718276-76718298 CAGGTTCTGCAGAAGATGCCGGG + Intronic
1151959811 17:77399754-77399776 CTGATTCTGCAGAAGCCCCAGGG - Intronic
1152840631 17:82565720-82565742 CTGTTTCCACAGCAGCTGCACGG - Intronic
1152920699 17:83065121-83065143 CTGGTTCTGCTGAAGCTGGAGGG - Intergenic
1154915960 18:20727432-20727454 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1154916829 18:20740795-20740817 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1154917940 18:20757536-20757558 CACTTTCTGTAGAATCTGCAAGG + Intergenic
1156015512 18:32542660-32542682 CCGTTTCCCCTGAAGTTGCAAGG + Intergenic
1157134261 18:45038624-45038646 ACGTTGCTGCAGATGCAGCAAGG - Exonic
1157818443 18:50748274-50748296 CTGTGACTGCAGGAGCTGCAGGG + Intergenic
1159108243 18:64027487-64027509 CCATTTCTCCAGCTGCTGCACGG - Intergenic
1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG + Intergenic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1164340281 19:24387818-24387840 CTTTTTCTGTAGAATCTGCAAGG + Intergenic
1164364460 19:27560897-27560919 CTGTTTATGTAGAAACTGCAAGG + Intergenic
1166863762 19:45824054-45824076 CCATGTCTGGAGGAGCTGCAGGG - Intronic
925808415 2:7674749-7674771 CCCTTGCTGCAGAAGCTCAAGGG - Intergenic
928950398 2:36808536-36808558 CCGCTTCACCAGAGGCTGCAGGG - Exonic
934472496 2:94564548-94564570 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
935262993 2:101371016-101371038 CCATTTCTGCAGACACTGCCAGG + Intronic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
935453759 2:103241734-103241756 CTTTTTCTACAGAACCTGCATGG + Intergenic
938761451 2:134430184-134430206 GGGTTTCAGCAGCAGCTGCAGGG - Intronic
938824886 2:134994968-134994990 CCCTTTCTCAAGAAGCTGCTGGG + Intronic
942555168 2:177165348-177165370 CCATGGCTGCAGAAGCTGTAGGG + Intergenic
947714815 2:232334152-232334174 CCGGTGCTGCAGAAGCTGCATGG + Intronic
947733885 2:232445083-232445105 CCGGTGCTGCGGAAGCTGCAGGG + Intergenic
948049301 2:234967531-234967553 AGGCTGCTGCAGAAGCTGCAGGG - Intronic
948353557 2:237360014-237360036 CAGTTTCTCCAGATGCTGCCAGG - Intronic
948373599 2:237505759-237505781 CCCTTTCTTCAGAGGCTGCCGGG + Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1171200511 20:23237378-23237400 TAATTTCTGCATAAGCTGCAAGG + Intergenic
1171406567 20:24915777-24915799 ACCTGTCTGCAGAATCTGCAGGG - Intergenic
1171575872 20:26315952-26315974 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1171740026 20:28872871-28872893 CTCTTTCTGTAGAATCTGCAAGG - Intergenic
1171744724 20:28958128-28958150 CCCTTTTTGTAGAATCTGCAAGG + Intergenic
1172406023 20:34689897-34689919 CCCCTTCTGCAGAATCTGGATGG - Intergenic
1173912562 20:46681131-46681153 GCTCTTCTGAAGAAGCTGCAGGG - Intronic
1174033174 20:47647337-47647359 CAGCTTCAGCAGAGGCTGCAGGG + Exonic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174920184 20:54693727-54693749 CAGTTTCTAATGAAGCTGCAAGG - Intergenic
1176318062 21:5269889-5269911 CCCTTTTTGTAGAATCTGCAAGG - Intergenic
1176318558 21:5280215-5280237 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1176322129 21:5339274-5339296 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1176475925 21:7206666-7206688 CCCTTTTTGTAGAATCTGCAAGG - Intergenic
1176476533 21:7219552-7219574 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1176479786 21:7271060-7271082 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1177099731 21:16885430-16885452 CTGTTTCAGCTGAAGCTGGATGG + Intergenic
1177245053 21:18512424-18512446 CTGTCTCTGAAGAAGTTGCAAGG - Intergenic
1180220127 21:46353265-46353287 CTGTTACAGCAGAGGCTGCAGGG + Exonic
1180310099 22:11215807-11215829 CACTTTTTGCAGAATCTGCAAGG + Intergenic
1180310110 22:11215978-11216000 CACTTTTTGCAGAATCTGCAAGG + Intergenic
1180325301 22:11368875-11368897 CTCTTTTTGCAGAATCTGCAAGG + Intergenic
1180395734 22:12334073-12334095 CCCTTTTTGTAGAATCTGCAAGG - Intergenic
1180395861 22:12336731-12336753 CTCTTTCTGTAGAATCTGCAAGG - Intergenic
1180396250 22:12344754-12344776 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1180403463 22:12519339-12519361 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1180403887 22:12528033-12528055 CTCTTTCTGTAGAATCTGCAAGG + Intergenic
1180404012 22:12530678-12530700 CCCTTTTTGTAGAATCTGCAAGG + Intergenic
1180426443 22:15193978-15194000 CTCTTTTTGCAGAATCTGCAAGG - Intergenic
1180604384 22:17046072-17046094 TCGTGTCTGGTGAAGCTGCATGG + Intergenic
1182686523 22:32124356-32124378 CCACTTCTGCAGAATCTGGAGGG + Intergenic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
1184595029 22:45508682-45508704 CTGCCTCTGCAGAGGCTGCATGG + Intronic
1184895145 22:47402467-47402489 CCGTTCCTGAAGTAGATGCATGG + Intergenic
1185109944 22:48895198-48895220 CCGTGTGTGCAGATGCAGCAAGG + Intergenic
950858296 3:16125692-16125714 CCGTTTCTCCAAAGGATGCACGG - Intergenic
951378397 3:21951877-21951899 CCATTTCTGCAGCACTTGCATGG + Intronic
952420027 3:33122289-33122311 CTGGTTCTGCAGAAGCAGCGGGG - Intronic
956239133 3:67109394-67109416 GTGTTTCTGCAGAAGCAACAAGG + Intergenic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
958207140 3:90416632-90416654 CACTTTCTGTAGAATCTGCAAGG - Intergenic
958218343 3:90624226-90624248 CTCTTTTTGCAGAATCTGCAAGG - Intergenic
958221531 3:90689942-90689964 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
969266305 4:6066337-6066359 CAGTTTCTGAAGGTGCTGCAAGG + Intronic
972025686 4:34373857-34373879 CTGTATCTGCAAAAGCAGCATGG - Intergenic
974870774 4:67638310-67638332 CCTTTTCTGCTTCAGCTGCATGG - Intronic
978042769 4:104090694-104090716 ATATTTGTGCAGAAGCTGCAAGG + Intergenic
978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG + Intergenic
981141570 4:141275656-141275678 CTGCTGCTGCAGAAGCTCCAAGG + Intergenic
981700268 4:147600242-147600264 ACATGTCTGAAGAAGCTGCAGGG - Intergenic
985638904 5:1054048-1054070 CCGTTGCTGCTGAAGCTCCCAGG + Intronic
986124543 5:4873103-4873125 CCGCTGCTCCAGAAGATGCATGG + Intergenic
986967780 5:13296141-13296163 CCCTTTCTACAATAGCTGCAAGG + Intergenic
987494872 5:18630506-18630528 CTGTTGCTTCAGAAGGTGCAAGG - Intergenic
989004602 5:36796430-36796452 CTGTTCCTGAAGATGCTGCAGGG + Intergenic
989216914 5:38914369-38914391 CAGATTCTGGGGAAGCTGCAGGG + Intronic
989831089 5:45920089-45920111 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
989833963 5:45960239-45960261 CCGTTTTTGTAGAATCTGCCAGG + Intergenic
989834990 5:45977203-45977225 CTGTTTTTGTAGAAGCTGCAAGG + Intergenic
989838201 5:46022901-46022923 CAGTTTTTGGAGAATCTGCAAGG + Intergenic
989838560 5:46029410-46029432 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
990401338 5:55440523-55440545 ATGTTTCTGCAGATGCAGCATGG - Intronic
991974006 5:72168208-72168230 CTGTTGCTGGAGAAGCTGGAAGG - Intronic
992888220 5:81180521-81180543 CTGTTTCCTCAGAAGCTGCAGGG - Intronic
994774504 5:104025960-104025982 CCATTTCAGGAGAGGCTGCAAGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996976518 5:129440826-129440848 CCCTTTCAGCAGAAGCAGAATGG + Intergenic
1000462597 5:161541520-161541542 CAATTTATGCAGAAGATGCAAGG - Intronic
1000676043 5:164123820-164123842 GCTATTTTGCAGAAGCTGCAAGG + Intergenic
1001100888 5:168813485-168813507 TCCTTTCAGCAGAAGCTGAAGGG + Intronic
1004516100 6:16323566-16323588 TGGTTTCTGCAGAGGCTGCCAGG + Intronic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1009063322 6:58423661-58423683 CTGCTTCTGTAGAATCTGCAAGG - Intergenic
1009063614 6:58428287-58428309 CTGTTTTTGCAGAAACTGCAAGG - Intergenic
1009253959 6:61351920-61351942 CTGTTTTTGGAGAATCTGCAAGG + Intergenic
1009253990 6:61352263-61352285 CTGTTTTTGGAGAATCTGCAAGG + Intergenic
1009258645 6:61453741-61453763 CTGTTTTTGGAGAATCTGCAAGG + Intergenic
1009258676 6:61454084-61454106 CTGTTTTTGGAGAATCTGCAAGG + Intergenic
1017724741 6:157269010-157269032 CATTTTCTTCAGAACCTGCAGGG - Intergenic
1017724818 6:157269562-157269584 CCTTTTCTTCTGAAGCTGCAGGG + Intergenic
1019531150 7:1504128-1504150 GCGATGCTGCAGGAGCTGCAGGG + Intronic
1019860573 7:3654651-3654673 CCCTTTCTCCTGAAGCAGCAGGG - Intronic
1023632494 7:42178265-42178287 GGGTCTCAGCAGAAGCTGCAGGG - Intronic
1025312059 7:57959771-57959793 CCATTTTTGTAGAATCTGCATGG - Intergenic
1025314628 7:58004425-58004447 CTCTTTCTGTAGAATCTGCAAGG + Intergenic
1025501157 7:61299945-61299967 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1025516017 7:61646168-61646190 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1025520304 7:61720596-61720618 GTCTTTCTGCAGAATCTGCAAGG - Intergenic
1025525832 7:61808971-61808993 CTGTTTTTGGAGAAACTGCAAGG + Intergenic
1025526931 7:61825673-61825695 CTGTTTTTGAAGAATCTGCAAGG - Intergenic
1025540354 7:62074994-62075016 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1025544626 7:62149251-62149273 GTCTTTCTGCAGAATCTGCAAGG - Intergenic
1025549223 7:62221704-62221726 CTGTTTTTGGAGAAACTGCAAGG + Intergenic
1025570566 7:62558267-62558289 CTCTTTTTGCAGAATCTGCAAGG - Intergenic
1025576405 7:62648163-62648185 CTGTTTTTGTAGAAACTGCAAGG - Intergenic
1025580497 7:62709179-62709201 CAGTTTTTGTAGAATCTGCAAGG - Intergenic
1025583682 7:62753327-62753349 CTGTTTATGTAGAACCTGCAAGG + Intergenic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1031201719 7:118696996-118697018 CCCTTTCAGCAGAAGAGGCATGG - Intergenic
1031800393 7:126236332-126236354 CCCTTTCTGCACATTCTGCATGG + Intergenic
1031969295 7:128052489-128052511 CCCTTTCAGCAGATGCTGCTAGG - Intronic
1032364305 7:131285052-131285074 CTTTTCCAGCAGAAGCTGCAGGG + Intronic
1033941347 7:146658977-146658999 CGGTGTCTCCAGTAGCTGCAGGG - Intronic
1034274643 7:149818680-149818702 CCCCTGCTCCAGAAGCTGCACGG + Intergenic
1038545323 8:28421745-28421767 GAGTTTCTGGGGAAGCTGCAAGG + Intronic
1038767569 8:30443125-30443147 CGGGTTGTGGAGAAGCTGCAGGG - Intronic
1041504255 8:58577014-58577036 CCCTTTCTCCAGAATCTTCAGGG + Intronic
1053954327 9:43442492-43442514 CTGTTTCTGTAGTATCTGCAAGG + Intergenic
1055602656 9:77935850-77935872 CTGTTTCTGAAGAAACTGAAGGG - Intronic
1056814361 9:89791051-89791073 TTGTTTCTGCAGAACCAGCAAGG + Intergenic
1056817333 9:89811496-89811518 CCGTCACTGCAGAAGCTGGGTGG + Intergenic
1056841363 9:90000226-90000248 CTCTTTCTGCAGGAGCAGCAGGG - Intergenic
1057371904 9:94480723-94480745 CTTTTTCTGCAGAATCTGAAGGG + Intergenic
1062195709 9:135272771-135272793 GCGTCTCTGCAGAGGCTGCTGGG - Intergenic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1203342014 Un_KI270425v1:1646-1668 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1203357381 Un_KI270442v1:170613-170635 CTCTTTTTGCAGAATCTGCAAGG + Intergenic
1203374441 Un_KI270442v1:352927-352949 CTCTTTCTGCAAAATCTGCAAGG + Intergenic
1203397175 Un_KI270519v1:33304-33326 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1203401379 Un_KI270519v1:103740-103762 CACTTTTTGCAGAATCTGCAAGG + Intergenic
1203411356 Un_KI270579v1:9352-9374 CCCTTTTTGTAGAATCTGCAAGG - Intergenic
1203411968 Un_KI270579v1:22238-22260 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1203413374 Un_KI270589v1:19367-19389 CTGTTTTTGTAGAATCTGCAAGG - Intergenic
1203684940 Un_KI270757v1:39845-39867 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1186195864 X:7110015-7110037 CAGCTTCTGTAGTAGCTGCAAGG + Intronic
1190931568 X:54953028-54953050 CTGTTTGTGTAGAAGCTGAAGGG + Intronic
1191262991 X:58348477-58348499 CTGTTTCCTCAGAATCTGCAAGG + Intergenic
1191263736 X:58359917-58359939 CTGTTTTTGTAGAATCTGCAAGG + Intergenic
1191571777 X:62634580-62634602 CTCTTTCTGTAGAATCTGCAAGG + Intergenic
1192495615 X:71615056-71615078 CCGTTTCTGCAGTTTCAGCAGGG + Intergenic
1201064496 Y:10081844-10081866 CTCTTTTTGCAGAATCTGCAAGG - Intergenic
1201065384 Y:10090843-10090865 CCCTTTTTGCAGATGCTCCAGGG + Intergenic
1201567850 Y:15385295-15385317 CAGCTTCTGCAGCAGCTGCAAGG + Intergenic
1201755319 Y:17480756-17480778 CCGTTTCTCCACAGGCAGCAGGG + Intergenic
1201846233 Y:18425229-18425251 CCGTTTCTCCACAGGCAGCAGGG - Intergenic
1202150487 Y:21839597-21839619 CTCTTTCTCCACAAGCTGCAGGG + Intergenic