ID: 1141083749

View in Genome Browser
Species Human (GRCh38)
Location 16:81076946-81076968
Sequence GGGCCTGAGGAGGATCCGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141083749_1141083768 17 Left 1141083749 16:81076946-81076968 CCCAACGGATCCTCCTCAGGCCC 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1141083768 16:81076986-81077008 CGCCCGCTCTGGGGAAGCCCCGG 0: 1
1: 0
2: 2
3: 16
4: 186
1141083749_1141083759 6 Left 1141083749 16:81076946-81076968 CCCAACGGATCCTCCTCAGGCCC 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1141083759 16:81076975-81076997 TCCCCAGACCCCGCCCGCTCTGG 0: 1
1: 0
2: 1
3: 23
4: 246
1141083749_1141083763 8 Left 1141083749 16:81076946-81076968 CCCAACGGATCCTCCTCAGGCCC 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1141083763 16:81076977-81076999 CCCAGACCCCGCCCGCTCTGGGG 0: 1
1: 0
2: 2
3: 26
4: 232
1141083749_1141083761 7 Left 1141083749 16:81076946-81076968 CCCAACGGATCCTCCTCAGGCCC 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1141083761 16:81076976-81076998 CCCCAGACCCCGCCCGCTCTGGG 0: 1
1: 1
2: 0
3: 30
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141083749 Original CRISPR GGGCCTGAGGAGGATCCGTT GGG (reversed) Intronic
900182192 1:1316046-1316068 AGGCCTAAGGTGGATCCCTTGGG + Intronic
900967126 1:5966644-5966666 TGGCCGGAGGTGGATCTGTTGGG - Intronic
905646209 1:39626580-39626602 GGCCCTGGGGAGGATGAGTTGGG + Exonic
907313420 1:53552720-53552742 GGGCCAGAGGAGGATCCAGCTGG + Intronic
911669058 1:100587599-100587621 GGGCCTGAGAATAATCCCTTAGG - Intergenic
916679494 1:167090957-167090979 GGGACTGAGGGGGTTCCTTTTGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
918180022 1:182079326-182079348 TGGACTCAGGAGGATCAGTTAGG + Intergenic
923104289 1:230842795-230842817 GGGCCAGAGGAGGATGGGTGAGG + Intronic
1069597624 10:69682578-69682600 GGGCAAGAGGAGGATCATTTTGG + Intergenic
1070853136 10:79584075-79584097 GGGCCTGAGGAGACTCCCATAGG - Intergenic
1070887943 10:79921230-79921252 GGGCCTGAGGAGACTCCCATAGG + Intergenic
1074116939 10:110463192-110463214 GGGCCTGAGGAGGAGGTGCTGGG + Intergenic
1075999470 10:126904146-126904168 GGGCCTGGGGAGGACCAGGTGGG - Intergenic
1077499269 11:2901960-2901982 GGGCCTGAGGAGGGGCAGTGTGG - Intronic
1084456599 11:69271299-69271321 GGGGCTGAGGAGGCTCCATCTGG + Intergenic
1086038448 11:82445135-82445157 GAGCCAGAGGAGGAGCTGTTAGG - Intergenic
1089492218 11:118890963-118890985 GGGCAGGAGGAGGATCACTTGGG + Intronic
1091616251 12:2053132-2053154 GGGCCTCAGGAGGACTCGCTGGG + Intronic
1091794661 12:3291139-3291161 GGACCTGCGGAGCATCCGGTGGG - Intergenic
1096089579 12:48889979-48890001 GGACCTGAGGAGGAGCACTTTGG - Intergenic
1096257473 12:50072267-50072289 GGGCCAGAGGAGGAGCAGTGGGG - Intronic
1101234104 12:102770712-102770734 GGGACTGAGGATGATGCATTAGG - Intergenic
1104366769 12:128185125-128185147 GGGACAGAGGAGGATTCTTTAGG - Intergenic
1104386440 12:128355317-128355339 GTGCCTGAGGAGGGTCCCTCTGG + Intronic
1104893593 12:132151538-132151560 GGGCCTCAGGGGGAGCCGTCAGG - Exonic
1104953819 12:132454267-132454289 GGTCCTGAGGAGGGACAGTTAGG + Intergenic
1119717546 14:76869304-76869326 GCGCCTGAGCAGGAGCCCTTGGG + Intronic
1121714765 14:96065734-96065756 GGGCCTTAGGAGGATGGGTGGGG - Intronic
1122663802 14:103315417-103315439 GGGCCAGAGCAGGATCCGTCAGG + Intergenic
1202902022 14_GL000194v1_random:49656-49678 TGGCCTGGGGAGCATCCATTTGG + Intergenic
1129600568 15:76995900-76995922 GGGCTTGAGGAGGATGTGTGGGG + Intronic
1129747870 15:78037578-78037600 GGGGCTGAGGATGTTCCCTTGGG - Intronic
1131164774 15:90134445-90134467 AGACCTGAGGAGGAGCAGTTTGG - Intergenic
1132931495 16:2461174-2461196 GGGCCTGAGGAGCAGCGGATGGG - Exonic
1133109824 16:3541386-3541408 GCCCGTGAGGAGCATCCGTTTGG - Intronic
1139951460 16:70674277-70674299 GGGCGTTAGGAGGATCAGTCAGG - Intronic
1140889544 16:79273192-79273214 GGGCCAGAGGAGGTTCCCTAGGG - Intergenic
1141083749 16:81076946-81076968 GGGCCTGAGGAGGATCCGTTGGG - Intronic
1142269163 16:89080158-89080180 GGGCCTGAGGAGGAGGAGTGTGG + Intergenic
1142425456 16:90000049-90000071 GGGCCGCAGGAGGCTCTGTTGGG + Intergenic
1144638644 17:16925997-16926019 TGGCCTGAGCAGGACCCATTGGG + Intergenic
1145965026 17:28910965-28910987 GGGAATGAGGAGTATCCTTTTGG - Intronic
1148751150 17:49946611-49946633 GAGCCTGAGGAGGCTCTCTTCGG + Intergenic
1151946523 17:77322858-77322880 TGGCCTGAGGAGGAGCCATGGGG + Intronic
1155374062 18:25136994-25137016 GAGACAGAGGAGGATCCTTTTGG - Intronic
1158384283 18:56971616-56971638 GGGTCTGGGGAGGATTGGTTAGG + Intronic
1160518843 18:79493205-79493227 GGCCGTGAGGAGGCTCCGCTGGG + Intronic
1161262245 19:3344420-3344442 GGGCTTGAGGTGGGTCCCTTTGG + Intergenic
1161978960 19:7620752-7620774 GGGGCTGAGGAGGAGCCTTCTGG - Intronic
1162001489 19:7747156-7747178 GGACCTGAGGAGGTTGAGTTTGG - Intronic
1162018862 19:7859757-7859779 GGGCCTGAGGAGGTGGCCTTGGG - Intronic
1166387327 19:42389532-42389554 GGCCCTGAGGAGGTGGCGTTGGG + Intronic
1166539082 19:43593821-43593843 GGGCCTAAGGAGGGTCAGTGAGG + Intronic
1166567096 19:43771942-43771964 GGGCCAGAGGATGACCAGTTTGG + Intronic
925059768 2:881728-881750 CGTCCTGAGGAGGATCAGTGTGG + Intergenic
926770579 2:16370045-16370067 ATGCCTGAGGAAGATCAGTTTGG - Intergenic
934504671 2:94880775-94880797 TGGCCTGGGGAGCATCCGTTTGG - Intergenic
936260411 2:110955633-110955655 GGGCCTGAAGAGAAGCCTTTGGG - Intronic
940807905 2:158208511-158208533 GGGCCTGTCGAGGAGCTGTTAGG + Intronic
942799774 2:179861573-179861595 GGGAATGAGGCGGAACCGTTCGG + Intergenic
943561890 2:189473609-189473631 GGGGCTGAGGAGGAGCTGTGGGG + Intronic
945039042 2:205729071-205729093 GGGGCTGAGGAGATTCCCTTTGG - Intronic
1173852411 20:46227470-46227492 GGGCCAGAGGCGGAGCCGTGGGG - Intronic
1175853241 20:62104857-62104879 GGGCCGGGGGAGGAGCCGTGTGG + Intergenic
1175892711 20:62322581-62322603 GGGCCTGGGGAGAATCTGATAGG - Intronic
1176621391 21:9064423-9064445 TGGCCTGGGGAGCATCCATTTGG + Intergenic
1180832317 22:18912485-18912507 TGGCCTGAGGAGGAGCCCTGCGG + Intronic
1181067525 22:20313857-20313879 TGGCCTGAGGAGGAGCCCTGCGG - Intergenic
1181546449 22:23605298-23605320 GGCCCTGGGGAGGACCTGTTGGG - Intergenic
1183741792 22:39672896-39672918 GGGCATGAGGAGGATCCCTCTGG - Intronic
1203282403 22_KI270734v1_random:137790-137812 TGGCCTGAGGAGGAGCCCTGCGG + Intergenic
950036798 3:9891794-9891816 GGATATGAGGAGGATACGTTTGG + Intronic
955387674 3:58492257-58492279 GGGGCTGAGGAGGATCTGGGCGG + Intronic
962459015 3:135591661-135591683 AGGCCTGAGGAGGAGGGGTTTGG - Intergenic
963384972 3:144581195-144581217 GTGCCAGAGGAGGAGCCGTTGGG + Intergenic
964620664 3:158717493-158717515 GGGCCTGAGGAGCAGCCATGGGG + Intronic
968947644 4:3673971-3673993 GGGCCTGAGGTGGGTCCGGCAGG + Intergenic
969717904 4:8877333-8877355 GGGCCTGAGGAGGAGGAGATGGG + Intergenic
976549561 4:86379173-86379195 GGACTTAAGGAGGATTCGTTGGG - Intronic
983824990 4:172248662-172248684 GGTCCTGAGAGGGATCCGGTGGG + Intronic
983875297 4:172868029-172868051 AGGCCAGAAGAGGATCCTTTGGG + Intronic
992687982 5:79216633-79216655 GGGCCCAAGGAGGATCACTTAGG + Intronic
1000477738 5:161732199-161732221 GGGACTTAGGAGGATACCTTTGG + Intergenic
1005888889 6:30120132-30120154 AGGCATGAGGAGGATCTGGTTGG + Intergenic
1007701169 6:43767389-43767411 GGGCCTTCGGAGGATTCTTTGGG + Intergenic
1016042162 6:139442511-139442533 GGGTTTGAGGAGAAGCCGTTGGG + Intergenic
1016767592 6:147812138-147812160 GAGGCTGAGGAGGACCAGTTAGG + Intergenic
1021085825 7:16420728-16420750 GGGCCTGAGGAGAAGCTGTGCGG - Intronic
1022100441 7:27166233-27166255 GGGCCGGCGGCGGCTCCGTTTGG - Intronic
1025177798 7:56810748-56810770 GGGCCTGGGGAGGATGATTTGGG + Intergenic
1029414977 7:100436703-100436725 GGCCCTGATGAGGACCCGTAGGG - Intergenic
1032510203 7:132466301-132466323 GGGCATGATGAGGACCCGTATGG + Intronic
1034413054 7:150951172-150951194 GGGCCTGAGCAGGGTCCCTGTGG - Intronic
1035643751 8:1202709-1202731 GAGACTGAGGAGGAAGCGTTGGG - Intergenic
1039616264 8:38957090-38957112 GGGCCTGGGGAGGGTCCATCTGG + Intronic
1039907477 8:41797576-41797598 GGGCTTGAGGAGGAGCAGCTGGG + Intronic
1039910411 8:41822376-41822398 GGGAATGAGGTGGATCCGTTTGG + Intronic
1041882393 8:62766866-62766888 GGGCTTGAGCAGGTTCCCTTGGG + Intronic
1042717395 8:71789536-71789558 GGGCCTGAGGGGGATCATCTGGG + Intergenic
1045317998 8:101059837-101059859 GGGGCTGTGGAGGATGGGTTGGG - Intergenic
1048314841 8:133354173-133354195 GGGCCTTAGGAGGATGCAGTTGG + Intergenic
1048367012 8:133746854-133746876 GGGCCAGAGGAAGATGGGTTGGG + Intergenic
1049475243 8:142794253-142794275 GGGTTTGAGGAGGAGCAGTTTGG - Intergenic
1060990643 9:127846795-127846817 GGGTCAGAGGAGGAGCCGCTGGG + Intronic
1062168944 9:135123728-135123750 GGGCCAGGGGAGGATTCGATGGG - Intergenic
1062431010 9:136526895-136526917 AGGCCTGAGGAGGCTCCCGTGGG + Intronic
1203744588 Un_GL000218v1:34893-34915 TGGCCTGGGGAGCATCCATTTGG + Intergenic
1203565513 Un_KI270744v1:84591-84613 TGGCCTGGGGAGCATCCATTTGG - Intergenic
1185460578 X:331227-331249 GAGCCTGGGGAGCAGCCGTTCGG - Intergenic
1189337087 X:40176595-40176617 GGGCCGGACGAGGAATCGTTGGG - Intronic
1190456594 X:50633938-50633960 GGGTCTGAGGAGGATGGGTCAGG + Exonic