ID: 1141083766

View in Genome Browser
Species Human (GRCh38)
Location 16:81076984-81077006
Sequence GGGGCTTCCCCAGAGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141083766_1141083778 28 Left 1141083766 16:81076984-81077006 CCCGCCCGCTCTGGGGAAGCCCC 0: 1
1: 0
2: 3
3: 19
4: 267
Right 1141083778 16:81077035-81077057 CTCTCGCTTCCTTTCGAACGAGG 0: 1
1: 0
2: 0
3: 12
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141083766 Original CRISPR GGGGCTTCCCCAGAGCGGGC GGG (reversed) Intronic
900284022 1:1890751-1890773 CGGGCGCCCCCAGGGCGGGCGGG + Intronic
900427807 1:2588411-2588433 CGGGCTTCCCCAGAGCTGCTGGG - Exonic
901022483 1:6262172-6262194 GGAGCTTGCCCAGTCCGGGCAGG + Intergenic
901037479 1:6344992-6345014 GCTGCTTCCCAGGAGCGGGCAGG + Intronic
901186314 1:7375628-7375650 GGGCCTTCCCCTGTGCAGGCTGG + Intronic
901795522 1:11677277-11677299 GGGGCTGCCCCAGAGGGTTCGGG - Intronic
902053641 1:13583268-13583290 GGGGCTGCCCCAGAGCTGGCTGG - Intergenic
902602890 1:17552023-17552045 GGGGCTTTCCCAGAGCTGCACGG + Intronic
903325596 1:22567053-22567075 GGGGCTTCCCCCAGGAGGGCAGG + Intronic
904015676 1:27418553-27418575 GGGGCTTCCCCAGAGGGGGAGGG - Intronic
904449568 1:30602164-30602186 GAGGCTTCCACAGAGCGGTGAGG + Intergenic
904624121 1:31792652-31792674 GGGGGTGCCCAAGAGTGGGCAGG + Intronic
905765346 1:40595772-40595794 TGGGGCTCCCCAGAGCAGGCCGG + Intergenic
905796363 1:40818723-40818745 GGGGCACGACCAGAGCGGGCAGG + Intronic
906290690 1:44617600-44617622 TTGGCTTCCCGAGAGCGGGCAGG - Intronic
906521140 1:46467584-46467606 GGGGCTGGCCCAGAGGGGCCTGG - Intergenic
911061320 1:93750688-93750710 GTGGCTTCCCCACAGCGTGGTGG - Intronic
914932738 1:151949456-151949478 GTGGCTGCCCCAGAGCCTGCAGG - Intergenic
915316031 1:155029731-155029753 AGGGCTTCCCCGGGGTGGGCAGG - Intronic
915623444 1:157099763-157099785 GGGAGGTCCCCAGAGGGGGCTGG - Exonic
917944509 1:179955016-179955038 GGTGCGTCCCCGGAGCGGGGAGG + Exonic
918306598 1:183252299-183252321 GCCGCCTCCCCAGAGCGTGCTGG + Exonic
919747219 1:201016491-201016513 CCGCCTTCCCCAGAGCTGGCAGG - Intronic
920443066 1:205994338-205994360 GGGGCCTCCCCAAAGCTGGAAGG + Exonic
922701658 1:227764710-227764732 GGGGCTTCACCATATCGGTCAGG - Intronic
1062787312 10:275924-275946 GAGGCTCACACAGAGCGGGCTGG + Exonic
1063067088 10:2621065-2621087 GGGGCCTCTGCAGAGCTGGCTGG + Intergenic
1063121071 10:3106135-3106157 GGGGCCTCCCCTGGGAGGGCCGG + Intronic
1064443111 10:15371078-15371100 CGGGCTCGCCGAGAGCGGGCCGG + Intergenic
1065114979 10:22476393-22476415 GGGGATGCGCCCGAGCGGGCTGG - Intergenic
1066471379 10:35701410-35701432 GGGGCTGCTCCGGAGGGGGCAGG - Intergenic
1067711738 10:48655993-48656015 GGGCCTCCAGCAGAGCGGGCGGG + Intronic
1069086980 10:64152086-64152108 GGGGCTTCACCATAGCGAACAGG - Intergenic
1072873643 10:99148597-99148619 GGGGCTTCACCAGGTTGGGCAGG - Intronic
1076896198 10:133313476-133313498 GGTGCTGCCCCAGAGGGTGCAGG + Intronic
1077148142 11:1055005-1055027 GGGAGTTCCCCGGAGCAGGCAGG - Intergenic
1077227225 11:1443653-1443675 GGGGCGGCCCCAGAGCGTGGCGG + Intronic
1077487975 11:2847855-2847877 GCGGCCCCCCCAGAGAGGGCGGG + Exonic
1081488220 11:43547783-43547805 GGGGCTTCCCCGGGGGGGGGGGG + Intergenic
1081810479 11:45911312-45911334 GGGGCTTCCCGAGGGCAGGGTGG - Intronic
1083203234 11:61132385-61132407 AGGGCTTCCCAGGAGCTGGCCGG - Exonic
1083729949 11:64647512-64647534 GGCCCCTCCCCAGAGAGGGCAGG - Intronic
1083872701 11:65499067-65499089 GGGGCTTCTGCTGAGGGGGCAGG + Intergenic
1084669183 11:70595263-70595285 GGGGCTTCCTGAGAGGGGGTCGG - Intronic
1088151443 11:106750117-106750139 GTGGCTTCCCCAGGGCTGTCAGG - Intronic
1089061740 11:115631474-115631496 GGGGTTACCCCAGAGAGGCCAGG + Intergenic
1090010087 11:123038467-123038489 GGGGTTTCACCATATCGGGCAGG + Intergenic
1090641595 11:128734031-128734053 GCAGCTTCCCCAGAGCGCCCAGG + Intronic
1096179039 12:49540550-49540572 GAGGCTGGCCCAGAGCTGGCAGG + Intronic
1096517977 12:52168452-52168474 GGGGATTCCCCAGTGGTGGCAGG - Intergenic
1097787082 12:63772756-63772778 GTGGCACCCCCAGAGAGGGCAGG - Intergenic
1101201107 12:102437170-102437192 GGGGCATCCCCAGGGCTGGCTGG + Intronic
1102001542 12:109560915-109560937 GGGGCCTCTGCACAGCGGGCAGG - Intronic
1102779154 12:115548572-115548594 GAGGTTTCCCCAGAGAAGGCTGG - Intergenic
1103066897 12:117906415-117906437 GGGGTTTCCCCAGATTGGCCAGG - Intronic
1103400522 12:120640523-120640545 GGGGCTCCCCCAGGGCGGGGCGG + Intergenic
1104918376 12:132278076-132278098 GGGGCTTCCCCAGAGCCCGCAGG - Intronic
1109123423 13:58487373-58487395 GGGGCTTCCCTGGAGCAGTCTGG - Intergenic
1119418608 14:74493145-74493167 GGGCCTTCCACAGAGGGCGCGGG + Intronic
1121276788 14:92673695-92673717 GGGGCTTCCCCACATTGGCCAGG + Intronic
1121615672 14:95311951-95311973 GAGGCTTCCCGACAGAGGGCAGG - Intronic
1122408617 14:101514675-101514697 GGGGCTGCCCCTGAGGGGCCTGG - Intergenic
1122411636 14:101528787-101528809 TGGGCCTCCCCAGAGGGGCCGGG + Intergenic
1123035441 14:105469995-105470017 GGGGCCTTCCCAGGGCAGGCGGG + Intronic
1123908895 15:24947435-24947457 GGGGATTCACCATAGTGGGCAGG - Intronic
1124073170 15:26414578-26414600 GGGGTTTCCCCATATTGGGCAGG - Intergenic
1124215930 15:27807096-27807118 AGGGCTTCCCCAGAGGTGGGCGG - Intronic
1126291542 15:47085862-47085884 GGGGTTTCCCCATATCGGCCAGG - Intergenic
1129906331 15:79190273-79190295 GGGGCTGCCCCAGAGGAGTCAGG + Intergenic
1130014594 15:80176746-80176768 GTGGCCTCCCCCGGGCGGGCAGG - Intronic
1132870041 16:2111920-2111942 GGGGCTTCTGCCGAGCGGGTGGG - Intronic
1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG + Intronic
1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134717382 16:16363681-16363703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134949435 16:18344964-18344986 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1134957370 16:18388478-18388500 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1136508590 16:30722252-30722274 GGGGCTGCCCCACAGCAAGCTGG - Exonic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1137764472 16:50967427-50967449 CGGGCTTTCCCAGAGCAGCCGGG - Intergenic
1138488436 16:57361673-57361695 GAGGCTACCGCAGAGAGGGCAGG - Intronic
1138567745 16:57845957-57845979 GGGGCTGCCCCAGAGCTGTGGGG + Intronic
1138956035 16:61971521-61971543 GTGGCGTGCCCAGAGAGGGCAGG - Intronic
1139708778 16:68760815-68760837 GGAGCTTCCCCAGAGTGGGGAGG + Intronic
1140207844 16:72948128-72948150 CGGGCTTCGCCACAGGGGGCGGG - Intronic
1141068455 16:80932495-80932517 GGGCCTTCCCGAGAGCGGCCAGG - Intergenic
1141083766 16:81076984-81077006 GGGGCTTCCCCAGAGCGGGCGGG - Intronic
1141428160 16:83956938-83956960 GCGGCTGCCCCAGAGATGGCAGG + Intronic
1141557721 16:84846872-84846894 GGGCCTTCCCCAGAGTAAGCTGG + Intronic
1141752513 16:85968312-85968334 GGGTCTCCCCGAGAGCTGGCTGG - Intergenic
1141909396 16:87048160-87048182 GGGGCTGCCCCGGGGCAGGCAGG - Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1142468955 17:151940-151962 GGGATTTCCCCAGAGTGGTCAGG - Intronic
1144633505 17:16888332-16888354 GGGGGTTCCACAGAGGGGTCAGG + Intergenic
1144758803 17:17695398-17695420 GAGGCTCCCCCAGGGCAGGCGGG - Intronic
1146022850 17:29293647-29293669 GGGGCATCCCCAGAGCCGGAGGG + Intronic
1146704303 17:34989471-34989493 GGGGCTTCCCCAGAGTTGTTGGG - Exonic
1146774071 17:35596729-35596751 GGCGCACACCCAGAGCGGGCTGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147559335 17:41499350-41499372 GTGCCTTCCTCAAAGCGGGCGGG - Intergenic
1148344613 17:46894979-46895001 TGGGATGCCCCAGAGCGGACAGG - Intergenic
1148786827 17:50149717-50149739 GGGGCATCCCCCGACGGGGCGGG + Exonic
1151544697 17:74785617-74785639 GGGACTTCCCCACAGGGGCCAGG + Intronic
1151986439 17:77547011-77547033 GGGGCTTCCCCAGCGGGAGAGGG + Intergenic
1152101572 17:78304738-78304760 GGGGAACCCCCAGAGCTGGCTGG - Intergenic
1152195623 17:78916594-78916616 GGGTCTTCCCCAGTGCAGGTGGG + Intronic
1152354333 17:79799353-79799375 GGGGCCTTCCCAGAGTGGGCCGG + Intronic
1152695308 17:81741140-81741162 GGGGGGTGCCCAGAGGGGGCAGG - Intergenic
1152757523 17:82093114-82093136 GGGGGATCCCCGGAGCTGGCAGG + Intronic
1152923740 17:83078637-83078659 AGGGCCTCCCCAGTCCGGGCGGG + Intergenic
1153781101 18:8495741-8495763 GGGGCTCCTGCAGAGAGGGCAGG - Intergenic
1153878941 18:9403928-9403950 GGGGCTGCTCCAGACCTGGCAGG + Intergenic
1154501814 18:15001152-15001174 GGGTCTACCCCAGAGTGAGCTGG + Intergenic
1155153047 18:23136774-23136796 GGGGCGTCCCCAGGGAGTGCGGG + Intronic
1155491497 18:26405625-26405647 TGGGCTTCCCCAGAGGGATCAGG + Intergenic
1160499020 18:79393409-79393431 CGGGCGTCTCCAGCGCGGGCCGG - Intergenic
1160557538 18:79735852-79735874 GAGGCGTGCCCAGAGCGAGCGGG + Intronic
1160791442 19:925563-925585 GGGGCTCCGCCTGGGCGGGCTGG - Intergenic
1160835587 19:1123128-1123150 GGGGCGTGGCCAGAGCTGGCGGG + Intronic
1161063383 19:2226346-2226368 AGGGCTCCTCCAGGGCGGGCCGG - Exonic
1161088331 19:2345178-2345200 GGGGCTTCCTGGGAGCGGGCGGG - Intronic
1161220126 19:3114577-3114599 GGGACTTCCCGAGAGAGGCCTGG - Intronic
1161397570 19:4052604-4052626 GGGGGAACCCCAGGGCGGGCGGG + Intronic
1161702127 19:5801468-5801490 TGGGCTGCCGCAGGGCGGGCCGG - Intergenic
1162046821 19:8005517-8005539 GGGGCTGCTCCGGGGCGGGCGGG + Exonic
1162523077 19:11193351-11193373 TGGGCCACCCCACAGCGGGCCGG - Exonic
1162547597 19:11339722-11339744 GGGGCTTTCAGAGAGCGGGTGGG + Intronic
1162727693 19:12699996-12700018 GGGGCTCCCCTAGAGAGGGTGGG - Exonic
1162742745 19:12782817-12782839 GGGGCTTCCCCAGCGCCTGACGG + Intronic
1162766677 19:12924179-12924201 GGGGCTTCCCGAGAACGTGTCGG - Exonic
1162797162 19:13092810-13092832 GAGGCATCCCCAGAGTGGGTGGG - Intronic
1163509381 19:17726082-17726104 GGGGCTTCCTCAGGCTGGGCCGG + Exonic
1164648061 19:29873490-29873512 GTGGCTGCCCGAGGGCGGGCGGG + Intergenic
1164986679 19:32653479-32653501 GTGGCGTCCTCAGAGCAGGCTGG - Intronic
1165072166 19:33261776-33261798 TGTGCTTTCCCAGAGCAGGCAGG - Intergenic
1166094476 19:40530546-40530568 GGGGCGTCCCTGCAGCGGGCGGG - Intronic
1167101118 19:47404798-47404820 GGTGATGCCCCAGAACGGGCAGG - Intronic
1167237051 19:48321509-48321531 GGGGCTTCCCCGTAAGGGGCGGG + Intronic
925228529 2:2208137-2208159 TGGGCTTCCCCTGAGACGGCTGG - Intronic
926260277 2:11253883-11253905 GTGTCTTCCCCAGAGCAGACAGG + Intronic
926878866 2:17518478-17518500 GGGGCGTGACCAGAGCGGCCCGG - Intergenic
927289279 2:21388819-21388841 GGAGCTTCCGCAGTGGGGGCTGG + Intergenic
928986189 2:37184637-37184659 GGGGTTTCCCCATATTGGGCAGG - Intronic
929792451 2:45033591-45033613 TGGGCTTCCCCACAGCATGCCGG - Intergenic
932423640 2:71615518-71615540 GGGGCTTCCCCAGAGGGCCAGGG - Intronic
932769376 2:74492084-74492106 GGGGCTACCCCAGGGAGGGTGGG - Intronic
934943100 2:98516506-98516528 GGAGCTTCCCCAGGGCTGGCAGG + Intronic
935360500 2:102242661-102242683 GAGCCTTCCCCAGAGCAGGTGGG - Intergenic
935670622 2:105553982-105554004 GGGGTTTCCCCATAGTGGCCAGG + Intergenic
937358756 2:121214433-121214455 GGGGCTTTACCAGTGCGGGGTGG + Intergenic
937792825 2:125980541-125980563 AGGGCTTCCCCAGAATGAGCAGG + Intergenic
938295211 2:130173736-130173758 GTGGCTTCCTCAGAGGGAGCTGG - Intronic
938340247 2:130531368-130531390 GGGGCAGCCCCAGGGTGGGCCGG + Intergenic
938349589 2:130589380-130589402 GGGGCAGCCCCAGGGTGGGCCGG - Intergenic
938500995 2:131831321-131831343 GGGTCTACCCCAGAGTGAGCTGG + Intergenic
938943197 2:136187246-136187268 GGGGCTGCCCCATACTGGGCTGG + Intergenic
940909234 2:159195865-159195887 AGGGCGTCCCCAGAGTTGGCAGG + Intronic
942320642 2:174732882-174732904 GGGGCTTCTCCATAGAGGTCAGG - Intergenic
946002609 2:216495324-216495346 GGGGCTTCACCATAACGGCCAGG - Intergenic
1170665291 20:18381289-18381311 GGAGCTTCCCCAGAAGGGACGGG - Intergenic
1171449557 20:25226045-25226067 TCGGCTTCCCCAGAGCAGCCAGG - Exonic
1172703011 20:36863930-36863952 GGTGCCTTCCCCGAGCGGGCAGG - Intergenic
1172853166 20:37981239-37981261 GGGGCCTCTCCAGAGCTGGCTGG + Intergenic
1173965194 20:47107331-47107353 GGGGTTTCACCATAACGGGCAGG - Intronic
1174115994 20:48226608-48226630 AGGGCTTCCCCAGGGCAGGAAGG + Intergenic
1174373443 20:50109975-50109997 GAGTCTTCCCCAGAGAGAGCTGG - Intronic
1176128522 20:63486694-63486716 GAGGGTTCCGCAGAGCAGGCAGG - Intergenic
1177471875 21:21570100-21570122 GGGGCTTCCCCAGATTTGGTAGG - Intergenic
1180162293 21:46003496-46003518 AGCGCTTCCTCACAGCGGGCAGG + Exonic
1181496908 22:23292331-23292353 GGAAATTCCACAGAGCGGGCAGG + Intronic
1183333483 22:37233833-37233855 AGGGCGTCCCCAGAGAAGGCAGG + Intronic
1183613522 22:38927327-38927349 GGGGTTGCCGCAGAGGGGGCTGG + Intergenic
1183688199 22:39374156-39374178 GGGGGATCCCCAGAGAGGGAGGG - Intronic
1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG + Intronic
1184692049 22:46121859-46121881 GGGGCTTCCAAAGAGAGGCCTGG + Intergenic
1184774505 22:46616568-46616590 GCGGCTTCCCCTGTGCGTGCAGG + Intronic
1184774549 22:46616758-46616780 GTGGCTTCCCCTGTGCGTGCAGG + Intronic
1184778118 22:46633362-46633384 GGGGGCTCCCCAGGGAGGGCAGG - Intronic
1185015592 22:48340870-48340892 GCAGCTTCCCCAGACTGGGCTGG - Intergenic
1185072891 22:48667003-48667025 TGGGCTTCCCCAGACAGGACTGG - Intronic
1185289051 22:50014930-50014952 GAGCCTTCCCCAGAGCGGCTCGG + Intergenic
950147729 3:10663803-10663825 GGGGCTTCCCCTGGGGAGGCAGG + Intronic
951831477 3:26933247-26933269 GGGGCTTCACCAGGGTGGCCAGG + Intergenic
954133048 3:48569784-48569806 GGGGCCTCCCCAGTTTGGGCGGG - Intronic
954386387 3:50246227-50246249 GGGGCTTCCCAGGGACGGGCTGG + Intronic
954638508 3:52084666-52084688 GGGGCTGCCCCAGAGCTGGGGGG - Intronic
954752355 3:52820845-52820867 GGGACCTCCCCAGAAGGGGCTGG - Intronic
956192740 3:66622648-66622670 AGGGCTTCCCCAGATAGAGCAGG - Intergenic
956783498 3:72623320-72623342 AGGGCTTCCCCAGTACTGGCTGG - Intergenic
957026990 3:75193306-75193328 GTGGCATACCCAGAGAGGGCTGG - Intergenic
960844377 3:121993269-121993291 GAGGCAGCCCCAGAGCTGGCGGG - Exonic
960955368 3:123027422-123027444 GGCGCTTCCCCTGCGCGGGTTGG - Intronic
961091127 3:124113688-124113710 TGGGCTGCCTCAGAGGGGGCAGG + Intronic
961133271 3:124488324-124488346 GAGGCTTCCCCAGTGCTGGGAGG - Intronic
961358244 3:126352195-126352217 GGGGCTTGCCCAGGGGAGGCAGG + Exonic
962263160 3:133927656-133927678 GGGGCGTCCCGTGGGCGGGCTGG + Intergenic
962841681 3:139238424-139238446 GGAGCTGCCACAGAGCAGGCTGG - Intronic
964383884 3:156126639-156126661 GGGGCTTACCCAGAGCCTCCAGG - Intronic
964411865 3:156406470-156406492 GGGGCTTCCCCAGGAAGAGCTGG - Intronic
966712005 3:182980685-182980707 GGGGCTTCCCCCGGGCGCGGGGG + Intronic
967055192 3:185824610-185824632 GGGCCGTCCCAGGAGCGGGCCGG + Intronic
967214483 3:187198957-187198979 GTGGCTGCCCCAGACCTGGCTGG + Intronic
968632935 4:1661537-1661559 GGGGCTTCCCCAGAGAGCCCGGG - Intronic
968702709 4:2064428-2064450 GGGCCTTCCCCAGTGGCGGCGGG - Exonic
968812900 4:2808170-2808192 GGGGCTTCCCCAGAGCCACCGGG - Intronic
970432351 4:16000844-16000866 GGGGCAGCTCCAGAGCAGGCGGG + Intronic
970601872 4:17647194-17647216 GGGTCTTCCCCACTTCGGGCAGG + Intronic
970976717 4:22050095-22050117 GGGGCTTCCCCAGAGGCAGCAGG + Intergenic
982490503 4:156023792-156023814 GGGGCTTCACCATATCGGTCAGG - Intergenic
983513306 4:168631679-168631701 GAGGCTTCCCGGGAGCCGGCGGG + Intronic
985472438 5:54144-54166 GGGGCTTCCCTAGAAGGCGCGGG - Intergenic
985675661 5:1230134-1230156 GGGGCTTTCACAGTGCAGGCTGG + Intronic
986323957 5:6657688-6657710 AGGGCATCCCCAGAGACGGCAGG + Intronic
987248817 5:16078706-16078728 GGGCCTTCCCCAGTGAGGGATGG + Intronic
990976499 5:61565808-61565830 GGGTCTTCTTCAGAGAGGGCCGG - Intergenic
992627648 5:78649114-78649136 GGAGCTTCCCCGGTGCGGCCCGG - Intronic
992866342 5:80960572-80960594 GCGGCCTCCCGAAAGCGGGCGGG + Intergenic
997469762 5:134110648-134110670 GGGGCTTGCCCAAAGCCGCCGGG - Intergenic
997657196 5:135564177-135564199 GGGGCCACCCCAGAGCTGCCTGG + Intergenic
999161739 5:149506426-149506448 GGGGCTTCACCATGTCGGGCAGG + Intronic
1000167651 5:158670276-158670298 GGGCATTTCCCAGAGCGAGCAGG - Intergenic
1002495705 5:179610119-179610141 GGTGCTGCCCCAGAGCCTGCAGG + Intergenic
1003306445 6:4933364-4933386 GGGGCTTCCACAGGGCAGCCTGG - Intronic
1004028577 6:11843426-11843448 GGGGCTTTGACAGAGCGGCCTGG - Intergenic
1004546552 6:16603705-16603727 GAGGCTTCACCAGAACAGGCAGG + Intronic
1004755094 6:18602021-18602043 GGGGGTTCCGAAGAGCTGGCTGG + Intergenic
1004924017 6:20402247-20402269 GGTACTGCTCCAGAGCGGGCTGG - Exonic
1006393383 6:33771937-33771959 CGGGCAGCCCCAGGGCGGGCGGG - Exonic
1006717692 6:36130760-36130782 GGGGCCAGCCCAGGGCGGGCTGG - Intronic
1013552156 6:111218385-111218407 GGGGCTTCCCCATGTTGGGCAGG - Intronic
1014001602 6:116371200-116371222 GGGGCTGTCCCGGCGCGGGCGGG + Intronic
1014271755 6:119344456-119344478 GGCCCTTCCCCAGAGCAGGGAGG - Intronic
1015994797 6:138987399-138987421 GGGGGGTCCCCGCAGCGGGCAGG - Intronic
1016988149 6:149910245-149910267 GGGGCTACCCCATAGCGAGGGGG + Intergenic
1018635944 6:165859568-165859590 GTGGCGTGCCCAGAGAGGGCAGG - Intronic
1018958886 6:168432197-168432219 GAGGCTTCCCCAGAGTGGACGGG - Intergenic
1019057768 6:169235514-169235536 AGGGCTTCCCCAGGGAGGCCTGG - Intronic
1019422690 7:958416-958438 TGGGCTTCCCTGGAGGGGGCCGG - Intronic
1019447671 7:1079792-1079814 GCTGCTTCCCCAGAGCTGGGAGG - Intronic
1019766926 7:2858261-2858283 GGGGTTTCCCCATGTCGGGCAGG - Intergenic
1020127692 7:5542038-5542060 GGGGCTTCCTCAGGGAGGTCAGG - Intronic
1022351093 7:29566434-29566456 TGGGCTCCCCGGGAGCGGGCTGG - Exonic
1023705061 7:42932473-42932495 GAAGCTTCCGCAGAGCCGGCCGG + Exonic
1026677040 7:72436689-72436711 GGGGTGTGCCCAGAGCAGGCAGG - Intronic
1029117966 7:98247526-98247548 GGTCCTTCCCCAGAGTGGGCAGG + Intronic
1029126462 7:98298136-98298158 GGGGCTTCTCCCAAGGGGGCAGG - Intronic
1029746469 7:102517918-102517940 CGGGGTTCCCCAGGGCGGGGAGG + Intergenic
1029764406 7:102616897-102616919 CGGGGTTCCCCAGGGCGGGGAGG + Intronic
1031852215 7:126878969-126878991 GGGGTTTCCCCATATTGGGCAGG - Intronic
1032083041 7:128869579-128869601 GGGGCCTGCCTGGAGCGGGCGGG - Intronic
1034627095 7:152502024-152502046 GGGGTTTCACCAGATTGGGCAGG - Intergenic
1034971623 7:155423208-155423230 GGGGCTGCTCCAGGGAGGGCGGG - Intergenic
1034976213 7:155450434-155450456 GCGGCTTCCTCAGAGGGCGCTGG + Intergenic
1037547760 8:19940170-19940192 CGGGGCTCCCCAGAGCGGGTGGG - Intronic
1037879477 8:22565900-22565922 GGGGCTGTCCCAGGCCGGGCGGG + Intronic
1038480551 8:27898926-27898948 GCGGCGTGCCCAGAGAGGGCAGG + Intronic
1038778364 8:30550754-30550776 GGGGCCTCCCCAAACCAGGCTGG + Intronic
1044727854 8:95207819-95207841 GGGCTTTCCCCAGAGGGAGCTGG + Intergenic
1045111006 8:98939844-98939866 GGGGCCTTCCCAGAGGGGCCCGG + Intronic
1047112121 8:121802114-121802136 GTGGCTTTCCCAGAGCAAGCAGG - Intergenic
1049209060 8:141377001-141377023 GGGGCTCCCCCAGGTCTGGCTGG - Intergenic
1049406262 8:142452987-142453009 GGGGCTGCCCAAGATGGGGCCGG - Intronic
1049426558 8:142540515-142540537 GGAGCTTCCTCAGAGCGGGAGGG + Intronic
1049659086 8:143811714-143811736 GGGGCTGGCCCTGAGCAGGCAGG - Intronic
1049778928 8:144418640-144418662 CCGGCTTCCCCAGAGCAGACGGG + Intergenic
1053137112 9:35658266-35658288 GTGGCCTCCCCGGAGCCGGCCGG + Intergenic
1053151948 9:35749138-35749160 GGCGCTGCCCCGGAGCCGGCCGG - Exonic
1055232134 9:74078294-74078316 GGGGCTTTCACAGTGGGGGCGGG + Intergenic
1056760890 9:89414342-89414364 GGGGTTTGCCCAGATGGGGCAGG + Intronic
1057291391 9:93809618-93809640 GGGGCTGCCCCAGAGCTGTAGGG + Intergenic
1057441810 9:95088968-95088990 GGGGCAGCCCCAGCACGGGCAGG - Intergenic
1057995524 9:99819645-99819667 GGGCCTTCCGCAGGGCGGGCGGG + Intergenic
1060657265 9:125380636-125380658 GGAAATTCCCCAGAGCGGGGTGG + Intergenic
1061080280 9:128365668-128365690 TGGGCATCCACAGAGTGGGCTGG + Intergenic
1061489822 9:130938737-130938759 GGGGCGGCCCGGGAGCGGGCGGG + Exonic
1061777122 9:132973077-132973099 GGGGCTCCCAGAGAGCCGGCTGG - Intronic
1062278897 9:135743326-135743348 GGGGCTTCCCAGGAGTGCGCAGG - Intronic
1062340120 9:136090427-136090449 GGGGCTTCCGCCCAGTGGGCTGG - Intronic
1062405379 9:136393749-136393771 GGGGCTTCCCCATGGCCGGGCGG - Intronic
1062498676 9:136843198-136843220 GGGTCTACCCCAGAGTGAGCTGG - Intronic
1062564278 9:137157044-137157066 GGGGCCTCCCCGGAGCTGGGCGG + Intronic
1062622036 9:137427559-137427581 GAGGCTGCCCCAGAGGGGTCTGG - Intronic
1187424634 X:19165979-19166001 GGGGCTTCCCCAGAACCCCCAGG - Intergenic
1189554334 X:42126458-42126480 GGGGCTTCCCCATGGGAGGCTGG + Intergenic
1190053748 X:47170343-47170365 GGTGCTTCCCCACTGTGGGCGGG + Intronic
1190213494 X:48466155-48466177 TGGGCTTCCCCAGGCTGGGCTGG - Intronic
1199770688 X:150973457-150973479 GGGGCTTCCCCTGAGGAGGTGGG + Intergenic
1202349513 Y:23972693-23972715 GGGGCTTCCCCAGAGGCCACTGG + Intergenic
1202521262 Y:25697411-25697433 GGGGCTTCCCCAGAGGCCACTGG - Intergenic