ID: 1141087798

View in Genome Browser
Species Human (GRCh38)
Location 16:81109096-81109118
Sequence CCCCGCCCCGTGCCATCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141087798_1141087804 26 Left 1141087798 16:81109096-81109118 CCAAGGGATGGCACGGGGCGGGG No data
Right 1141087804 16:81109145-81109167 TCACAGAGGCTCCGTATAGATGG No data
1141087798_1141087803 12 Left 1141087798 16:81109096-81109118 CCAAGGGATGGCACGGGGCGGGG No data
Right 1141087803 16:81109131-81109153 GCTTTTTCTAATCTTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141087798 Original CRISPR CCCCGCCCCGTGCCATCCCT TGG (reversed) Intergenic
No off target data available for this crispr