ID: 1141089667

View in Genome Browser
Species Human (GRCh38)
Location 16:81121555-81121577
Sequence CATGCTCATAGCTCATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141089667_1141089673 10 Left 1141089667 16:81121555-81121577 CCTGCTCATGAGCTATGAGCATG No data
Right 1141089673 16:81121588-81121610 GCACCACCATGTAGTAGAGGAGG No data
1141089667_1141089676 16 Left 1141089667 16:81121555-81121577 CCTGCTCATGAGCTATGAGCATG No data
Right 1141089676 16:81121594-81121616 CCATGTAGTAGAGGAGGAAGAGG No data
1141089667_1141089672 7 Left 1141089667 16:81121555-81121577 CCTGCTCATGAGCTATGAGCATG No data
Right 1141089672 16:81121585-81121607 CCTGCACCACCATGTAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141089667 Original CRISPR CATGCTCATAGCTCATGAGC AGG (reversed) Intergenic
No off target data available for this crispr