ID: 1141090462

View in Genome Browser
Species Human (GRCh38)
Location 16:81126840-81126862
Sequence GGTCTCCTGGGGTTAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141090462_1141090470 23 Left 1141090462 16:81126840-81126862 CCTTTCCTTAACCCCAGGAGACC No data
Right 1141090470 16:81126886-81126908 TACACCATCATAAACCACCTTGG No data
1141090462_1141090469 -1 Left 1141090462 16:81126840-81126862 CCTTTCCTTAACCCCAGGAGACC No data
Right 1141090469 16:81126862-81126884 CCTGTTTGTAGACAGAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141090462 Original CRISPR GGTCTCCTGGGGTTAAGGAA AGG (reversed) Intergenic
No off target data available for this crispr